Статья рб ук 189: Ошибка выполнения

Содержание

ЖК РФ Статья 56. Снятие граждан с учета в качестве нуждающихся в жилых помещениях

КонсультантПлюс: примечание.

Граждане, принятые на учет до 01.03.2005, снимаются с учета по основаниям пп. 1, 3 — 6 ч. 1 ст. 56 ЖК РФ или утраты оснований, которые до введения в действие ЖК РФ давали право на жилье по соцнайму (ФЗ от 29.12.2004 N 189-ФЗ).

Перспективы и риски споров в суде общей юрисдикции. Ситуации, связанные со ст. 56 ЖК РФ

Наниматель хочет обязать уполномоченный орган поставить его на учет по улучшению жилищных условий

Наниматель хочет обязать уполномоченный орган восстановить его на учете по улучшению жилищных условий

Наниматель хочет обязать уполномоченный орган предоставить ему благоустроенное жилое помещение

См. все ситуации, связанные со ст. 56 ЖК РФ

 

1. Граждане снимаются с учета в качестве нуждающихся в жилых помещениях в случае:

1) подачи ими по месту учета заявления о снятии с учета;

2) утраты ими оснований, дающих им право на получение жилого помещения по договору социального найма;3) их выезда на место жительства в другое муниципальное образование, за исключением случаев изменения места жительства в пределах городов федерального значения Москвы, Санкт-Петербурга и Севастополя;(в ред. Федерального закона от 21.07.2014 N 217-ФЗ)

(см. текст в предыдущей редакции)

4) получения ими в установленном порядке от органа государственной власти или органа местного самоуправления бюджетных средств на приобретение или строительство жилого помещения;

5) предоставления им в установленном порядке от органа государственной власти или органа местного самоуправления земельного участка (кроме садового земельного участка) для строительства жилого дома, за исключением граждан, имеющих трех и более детей, а также иных категорий граждан, определенных федеральным законом, указом Президента Российской Федерации или законом субъекта Российской Федерации;

(см. текст в предыдущей редакции)

6) выявления в представленных документах в орган, осуществляющий принятие на учет, сведений, не соответствующих действительности и послуживших основанием принятия на учет, а также неправомерных действий должностных лиц органа, осуществляющего принятие на учет, при решении вопроса о принятии на учет.

(в ред. Федерального закона от 03.12.2011 N 383-ФЗ)

(см. текст в предыдущей редакции)

2. Решения о снятии с учета граждан в качестве нуждающихся в жилых помещениях должны быть приняты органом, на основании решений которого такие граждане были приняты на данный учет, не позднее чем в течение тридцати рабочих дней со дня выявления обстоятельств, являющихся основанием принятия таких решений. Решения о снятии с учета граждан в качестве нуждающихся в жилых помещениях должны содержать основания снятия с такого учета с обязательной ссылкой на обстоятельства, предусмотренные частью 1 настоящей статьи. Решения о снятии с учета граждан в качестве нуждающихся в жилых помещениях выдаются или направляются гражданам, в отношении которых приняты такие решения, не позднее чем через три рабочих дня со дня принятия таких решений и могут быть обжалованы указанными гражданами в судебном порядке.

3. Граждане, принятые на учет в качестве нуждающихся в жилых помещениях органами местного самоуправления муниципального образования по месту жительства таких граждан и изменившие место жительства в связи с предоставлением таким гражданам по договорам найма жилых помещений жилищного фонда социального использования жилых помещений, расположенных в границах другого муниципального образования (в субъектах Российской Федерации — городах федерального значения Москве, Санкт-Петербурге и Севастополе — в муниципальном образовании другого субъекта Российской Федерации), не подлежат снятию с учета в качестве нуждающихся в жилых помещениях по предыдущему месту их жительства.

(часть 3 введена Федеральным законом от 21.07.2014 N 217-ФЗ)

Открыть полный текст документа

Заявление правозащитных организаций о признании трех новых политических заключенных

Совместное заявление представителей белорусского правозащитного сообщества

Минск, 25 марта 2021 г.

В связи с увеличением числа случаев осуждения и лишения свободы граждан страны по ряду диффамационных статей Уголовного кодекса Республики Беларусь, а также в связи с унижением государственных символов Республики Беларусь, мы, представители белорусского правозащитного сообщества, в очередной раз подтверждая свои неоднократно высказанные требования по декриминализации диффамации и недопустимости лишения свободы граждан за оскорбление должностных лиц, государства, государственных органов и символов (совместное заявление от 22 декабря 2020 г.),

 отмечаем следующее:

Нами получена информация о следующих лицах, лишенных свободы за оскорбление президента, представителей власти (сотрудников милиции) и оскорбление государственных символов:

  1. Владимир Шакун — осужден приговором суда Житковичского р-на на два года ограничения свободы с направлением в учреждения открытого типа по ч. 1 ст. 368 УК (Оскорбление президента Республики Беларусь), ст. 370 УК (оскорбление государственных символов), направлен для отбывания наказания;
  2. Илья Тананко — осужден приговором суда Фрунзенсага р-на г. Минска на полтора года ограничения свободы с направлением в исправительное учреждение открытого типа по ст. 369 УК (Оскорбление представителя власти), направлен для отбывания наказания;
  3. Ромуальд Улан — осужден приговором суда Сморгонского р-на на два с половиной года ограничения свободы с направлением в исправительное учреждение открытого типа по ст. 188 УК (поклеп), направлен для отбывания наказания;

В связи с этим мы считаем преследование и лишение свободы Владимира Шакуна, Ильи Тананко, Ромуальда Улана политически мотивированным, связанным с мирной реализацией выражения мнения, а их самих политическими заключенными в соответствии с п. 3.1(а) Руководства по определению понятия “политический заключенный”, и требуем от властей Беларуси:

  1. Немедленно освободить политзаключенных
    Владимира Шакуна, Илью Тананко, Ромуальда Улана
    и прекратить уголовное преследование в отношении них.
  2. Принять меры, направленные на декриминализацию диффамационных правонарушений и отмену статей Уголовного кодекса, предусматривающих ответственность за оскорбление государства, государственных символов и должностных лиц, а именно – ст. 188, 189, 367, 368, 369, 369-1, 370, 391 Уголовного кодекса Республики Беларусь, и прекратить все ранее возбужденные по данным статьям уголовные дела.
  3. Немедленно освободить всех политических заключенных и прекратить политические репрессии против граждан страны.

Правозащитный центр «Весна»;

«Инициатива FORB»;

Центр правовой трансформации Lawtrend;

Белорусский ПЕН-центр;

РПОО «Белорусский Хельсинкский комитет»;

Консультационный центр по актуальным международным практикам и их имплементации в праве «Хьюман Константа»;

Белорусский дом прав человека имени Бориса Звозскова.

Сеть-интернет и ответственности в соответствии с законодательством РБ

Сеть-интернет и ответственности в соответствии с законодательством Республики Беларусь

Статья 212 УК Республики Беларусь: хищение путем использования компьютерной техники — лишение свободы на срок до 3 лет. Те же действия, совершенные повторно либо в группе – на срок до 5 лет.

Статья 349 УК Республики Беларусь: несанкционированный доступ к компьютерной информации наказывается на срок до 2 лет лишения свободы.

Статья 343 УК Республики Беларусь: распространение порнографических материалов, изготовление либо хранение с целью распространения или рекламирования, либо распространение или рекламирование порнографических материалов, печатных изданий, изображений или иных предметов порнографического характера, содержащих изображение несовершеннолетних, либо демонстрация кино- или видеофильмов порнографического содержания несовершеннолетним, совершенные лицом, достигшим восемнадцатилетнего возраста, — наказываются лишением свободы на срок от одного года до трех лет.

Статья 9.2 Кодекса Республики Беларусь об административных правонарушениях: распространение заведомо ложных, позорящих другое лицо измышлений (клевета) — штраф от десяти до тридцати базовых величин.За распространение заведомо ложных, позорящих другое лицо измышлений (клевета), совершенное в течение года после наложения мер административного взыскания за клевету установлена уголовная ответственность (ч. 1 ст. 188 Уголовного кодекса Республики Беларусь).

Статья 9.3 Кодекса Республики Беларусь об административных правонарушениях: умышленное унижение чести и достоинства личности, выраженное в неприличной форме (оскорбление) — штраф от четырех до двадцати базовых величин. За умышленное унижение чести и достоинства личности, выраженное в неприличной форме (оскорбление), совершенное в течение года после наложения мер административного взыскания за оскорбление или клевету, установлена уголовная ответственность

(ч. 1 и ч. ст. 189 Уголовного кодекса Республики Беларусь).

Статья 9.4Кодекса Республики Беларусь об административных правонарушениях: невыполнение обязанностей по воспитанию детей, повлекшее совершение несовершеннолетним в возрасте до шестнадцати лет деяния, содержащего признаки административного правонарушения, либо преступления, административная или уголовная ответственность за которые наступает после достижения этого возраста, — влечет предупреждение или наложение штрафа в размере до десяти базовых величин.

Ответственность за совершение правонарушений (преступлений) в сфере семейно-бытовых отношений

Семейно-бытовые правонарушения относятся к числу сложных социальных проблем. Несмотря на родственные связи между людьми в семье и быту, как показывает практика, именно в этой сфере взаимоотношений достаточно часто совершаются преступления и административные правонарушения. К данной категории правонарушений относятся противоправные деяния, посягающие на жизнь и здоровье, личную свободу, честь и достоинство человека, общественный порядок, в основе которых лежат неприязненные взаимоотношения, либо внезапно возникшие конфликты между членами семьи.

Что может быть за совершение правонарушений и преступлений?

Административная ответственность

За совершение правонарушений в сфере семейно-бытовых отношений семейный агрессор может быть привлечён к административной ответственности по статьям:

ст.9.1 КоАП Республики Беларусь «Умышленное причинение телесного повреждения и иные насильственные действия либо нарушение защитного предписания». Может быть наложено административное взыскание в виде штрафа в размере до тридцати базовых величин или административный арест до 15 суток. 

Необходимо отметить, что в соответствии с ч.1 ст.9.1 КоАП РБ, лицо может привлечено к административной ответственности за умышленное причинение телесного повреждения, не повлекшего за собой кратковременного расстройства здоровья или незначительной стойкой утраты трудоспособности, а в соответствии с ч.2 ст.9.1 КоАП РБ лицо может быть привлечено к административной ответственности за нанесение побоев, не повлекших причинения телесных повреждений, умышленной боли, физических или психических страданий, если в этих действиях нет состава преступления.

ст.9.3 КоАП Республики Беларусь «Оскорбление». Может быть наложено административное взыскание в виде штрафа в размере до двадцати базовых величин.

ст.17.1 КоАП Республики Беларусь «Мелкое хулиганство». Может быть наложено административное взыскание в виде штрафа в размере от двух до тридцати базовых величин или административный арест до 15 суток.

Уголовная ответственность

К бытовым преступлениям в УК Республик Беларусь отнесено 27 статей, сюда входят: 

ст.139 УК РБ «Убийство». Наказание – лишение свободы на срок до двадцати пяти лет, или пожизненное заключение, или смертная казнь;

ст.147 УК РБ «Умышленное причинение тяжкого телесного повреждения». Наказание – лишением свободы на срок до пятнадцати лет;

ст. 149 УК РБ «Умышленное причинение менее тяжкого телесного повреждения». Наказание – лишение свободы на срок до пяти лет;

ст.153 УК РБ «Умышленное причинение легкого телесного повреждения». Наказание – исправительные работы на срок до одного года, или арест;

ст. 154 УК РБ «Истязание». Наказание –  лишение свободы на срок до пяти лет;

ст.186 УК РБ «Угроза убийством, причинением тяжких телесных повреждений или уничтожением имущества». Наказание – лишение свободы на срок до двух лет;

ст.189 УК РБ «Оскорбление». Наказание – ограничение свободы на срок до трех лет;

ст. 166 УК РБ «Изнасилование». Наказание – лишение свободы на срок до пятнадцати лет; 

ст.167 УК РБ «Насильственные действия сексуального характера». Наказание – лишение свободы на срок до пятнадцати лет,   –  и другие преступления.

Наименования и коды стран мира | ФАО

Австралия Австралия AUS AU 36 AUS 10 17
Австрия Австрийская Республика AUT AT 40 AUT 11 18
Азербайджан Азербайджанская Республика AZE AZ 31 AZE 52 19
Албания Республика Албания ALB AL 8 ALB 3 3
Алжир Алжирская Народная Демократическая Республика DZA DZ 12 DZA 4 4
Ангола Республика Ангола AGO AO 24 AGO 7 8
Андорра Княжество Андорра AND AD 20 AND 6 7
Антигуа и Барбуда Антигуа и Барбуда ATG AG 28 ATG 8 11
Аргентина Аргентинская Республика ARG AR 32 ARG 9 12
Армения Республика Армения ARM AM 51 ARM 1 13
Намибия Республика Намибия NAM NA 516 NAM 147 172
Науру Республика Науру NRU NR 520 NRU 148 173
Непал Федеративная Демократическая Республика Непал NPL NP 524 NPL 149 175
Нигер Республика Нигер NER NE 562 NER 158 181
Нигерия Федеративная Республика Нигерия NGA NG 566 NGA 159 182
Нидерланды Королевство Нидерландов NLD NL 528 NLD 150 177
Никарагуа Республика Никарагуа NIC NI 558 NIC 157 180
Ниуэ Ниуэ NIU NU 570 NIU 160 183
Новая Зеландия Новая Зеландия NZL NZ 554 NZL 156 179
Норвегия Королевство Норвегия NOR NO 578 NOR 162 186
Республика Молдова Республика Молдова MDA MD 498 MDA 146 165
Республика Корея Республика Корея KOR KR 410 KOR 117 202
Российская Федерация Российская Федерация RUS RU 643 RUS 185 204
Руанда Республика Руанда RWA RW 646 RWA 184 205
Румыния Румыния ROU RO 642 ROU 183 203
Сальвадор Республика Эль-Сальвадор SLV SV 222 SLV 60 75
Самоа Независимое Государство Самоа WSM WS 882 WSM 244 212
Сан-Томе и Принсипи Демократическая Республика Сан-Томе и Принсипи STP ST 678 STP 193 214
Сан-Марино Республика Сан-Марино SMR SM 674 SMR 192 213
Саудовская Аравия Королевство Саудовская Аравия SAU SA 682 SAU 194 215
Северная Македония Республика Северная Македония MKD MK 807 MKD 154 241
Сейшельские Острова Республика Сейшельские Острова SYC SC 690 SYC 196 220
Сенегал Республика Сенегал SEN SN 686 SEN 195 217
Сент-Китс и Невис Сент-Китс и Невис KNA KN 659 KNA 188 208
Сент-Винсент и Гренадины Сент-Винсент и Гренадины VCT VC 670 VCT 191 211
Сент-Люсия Сент-Люсия LCA LC 662 LCA 189 209
Сербия Республика Сербия SRB RS 688 SRB 272 2648
Сингапур Республика Сингапур SGP SG 702 SGP 200 222
Сирийская Арабская Республика Сирийская Арабская Республика SYR SY 760 SYR 212 238
Словакия Словацкая Республика SVK SK 703 SVK 199 223
Словения Республика Словения SVN SI 705 SVN 198 224
Соединенное Королевство Великобритании и Северной Ирландии Соединенное Королевство Великобритании и Северной Ирландии GBR GB 826 GBR 229 256
Соединенные Штаты Америки Соединенные Штаты Америки USA US 840 USA 231 259
Соломоновы Острова Соломоновы Острова SLB SB 90 SLB 25 225
Сомали Федеративная Республика Сомали SOM SO 706 SOM 201 226
Сьерра-Леоне Республика Сьерра-Леоне SLE SL 694 SLE 197 221
Судан Республика Судан SDN SD 729 SDN 276 40764
Суринам Республика Суринам SUR SR 740 SUR 207 233
Таджикистан Республика Таджикистан TJK TJ 762 TJK 208 239
Таиланд Королевство Таиланд THA TH 764 THA 216 240
Тимор-Лешти Демократическая Республика Тимор-Лешти TLS TL 626 TLS 176 242
Того Тоголезская Республика TGO TG 768 TGO 217 243
Токелау Токелау TKL TK 772 TKL 218 244
Тонга Королевство Тонга TON TO 776 TON 219 245
Тувалу Тувалу TUV TV 798 TUV 227 252
Тунис Тунисская Республика TUN TN 788 TUN 222 248
Туркменистан Туркменистан TKM TM 795 TKM 213 250
Турция Турецкая Республика TUR TR 792 TUR 223 249
Тринидад и Тобаго Республика Тринидад и Тобаго TTO TT 780 TTO 220 246
Уганда Республика Уганда UGA UG 800 UGA 226 253
Узбекистан Республика Узбекистан UZB UZ 860 UZB 235 261
Украина Украина UKR UA 804 UKR 230 254
Уругвай Восточная Республика Уругвай URY UY 858 URY 234 260
Фарерские острова Фарерские острова FRO FO 234 FRO 64 82
Фиджи Республика Фиджи FJI FJ 242 FJI 66 83
Филиппины Республика Филиппины PHL PH 608 PHL 171 196
Финляндия Финляндская Республика FIN FI 246 FIN 67 84
Франция Французская Республика FRA FR 250 FRA 68 85
Хорватия Республика Хорватия HRV HR 191 HRV 98 62
Центральноафриканская Республика Центральноафриканская Республика CAF CF 140 CAF 37 49
Чад Республика Чад TCD TD 148 TCD 39 50
Чехия Чешская Республика CZE CZ 203 CZE 167 65
Черногория Черногория MNE ME 499 MNE 273 2647
Чили Республика Чили CHL CL 152 CHL 40 51
Швейцария Швейцарская Конфедерация CHE CH 756 CHE 211 237
Швеция Королевство Швеция SWE SE 752 SWE 210 236
Шри-Ланка Демократическая Социалистическая Республика Шри-Ланка LKA LK 144 LKA 38 231
Эквадор Республика Эквадор ECU EC 218 ECU 58 73
Экваториальная Гвинея Республика Экваториальная Гвинея GNQ GQ 226 GNQ 61 76
Эсватини Королевство Эсватини SWZ SZ 748 SWZ 209 235
Эстония Эстонская Республика EST EE 233 EST 63 78
Эфиопия Федеративная Демократическая Республика Эфиопия ETH ET 231 ETH 238 79
Эритрея Государство Эритрея ERI ER 232 ERI 178 77
Южная Африка Южно-Африканская Республика ZAF ZA 710 ZAF 202 227
Южный Судан Республика Южный Судан SSD SS 728 SSD 277 74
Ямайка Ямайка JAM JM 388 JAM 109 123
Япония Япония JPN JP 392 JPN 110 126
Маврикий Республика Маврикий MUS MU 480 MUS 137 160
Мавритания Исламская Республика Мавритания MRT MR 478 MRT 136 159
Мадагаскар Республика Мадагаскар MDG MG 450 MDG 129 150
Малави Республика Малави MWI MW 454 MWI 130 152
Малайзия Малайзия MYS MY 458 MYS 131 153
Мали Республика Мали MLI ML 466 MLI 133 155
Мальдивские Острова Мальдивская Республика MDV MV 462 MDV 132 154
Мальта Республика Мальта MLT MT 470 MLT 134 156
Марокко Королевство Марокко MAR MA 504 MAR 143 169
Маршалловы Острова Республика Маршалловы Острова MHL MH 584 MHL 127 157
Мексика Мексиканские Соединенные Штаты MEX MX 484 MEX 138 162
Микронезия (Федеративные Штаты) Федеративные Штаты Микронезии FSM FM 583 FSM 145 163
Мозамбик Республика Мозамбик MOZ MZ 508 MOZ 144 170
Монако Княжество Монако MCO MC 492 MCO 140 166
Монголия Монголия MNG MN 496 MNG 141 167
Мьянма Республика Союз Мьянма MMR MM 104 MMR 28 171
Кабо-Верде Республика Кабо-Верде CPV CV 132 CPV 35 47
Казахстан Республика Казахстан KAZ KZ 398 KAZ 108 132
Камбоджа Королевство Камбоджа KHM KH 116 KHM 115 44
Камерун Республика Камерун CMR CM 120 CMR 32 45
Канада Канада CAN CA 124 CAN 33 46
Катар Государство Катар QAT QA 634 QAT 179 201
Кения Республика Кения KEN KE 404 KEN 114 133
Кипр Республика Кипр CYP CY 196 CYP 50 64
Китай Китайская Народная Республика CHN CN 156 CHN 41 53
Кирибати Республика Кирибати KIR KI 296 KIR 83 135
Колумбия Республика Колумбия COL CO 170 COL 44 57
Коморские Острова Союз Коморских Островов COM KM 174 COM 45 58
Конго Республика Конго COG CG 178 COG 46 59
Коста-Рика Республика Коста-Рика CRI CR 188 CRI 48 61
Кот-д’Ивуар Республика Кот-д’Ивуар CIV CI 384 CIV 107 66
Корейская Народно-Демократическая Республика Корейская Народно-Демократическая Республика PRK KP 408 PRK 116 67
Куба Республика Куба CUB CU 192 CUB 49 63
Кувейт Государство Кувейт KWT KW 414 KWT 118 137
Кыргызстан Кыргызская Республика KGZ KG 417 KGZ 113 138
Пакистан Исламская Республика Пакистан PAK PK 586 PAK 165 188
Палау Республика Палау PLW PW 585 PLW 180 189
Панама Республика Панама PAN PA 591 PAN 166 191
Папуа – Новая Гвинея Независимое государство Папуа – Новая Гвинея PNG PG 598 PNG 168 192
Парагвай Республика Парагвай PRY PY 600 PRY 169 194
Перу Республика Перу PER PE 604 PER 170 195
Польша Республика Польша POL PL 616 POL 173 198
Португалия Португальская Республика PRT PT 620 PRT 174 199
Объединенная Республика Танзания Объединенная Республика Танзания TZA TZ 834 TZA 215 257
Объединенные Арабские Эмираты Объединенные Арабские Эмираты ARE AE 784 ARE 225 255
Оман Султанат Оман OMN OM 512 OMN 221 187
Острова Кука Острова Кука COK CK 184 COK 47 60
Израиль Государство Израиль ISR IL 376 ISR 105 121
Индия Республика Индия IND IN 356 IND 100 115
Индонезия Республика Индонезия IDN ID 360 IDN 101 116
Иордания Иорданское Хашимитское Королевство JOR JO 400 JOR 112 130
Исландия Республика Исландия ISL IS 352 ISL 99 114
Испания Королевство Испания ESP ES 724 ESP 203 229
Италия Итальянская Республика ITA IT 380 ITA 106 122
Ирак Республика Ирак IRQ IQ 368 IRQ 103 118
Иран (Исламская Республика) Исламская Республика Иран IRN IR 364 IRN 102 117
Ирландия Ирландия IRL IE 372 IRL 104 119
Замбия Республика Замбия ZMB ZM 894 ZMB 251 270
Зимбабве Республика Зимбабве ZWE ZW 716 ZWE 181 271
Багамские Острова Содружество Багамских Островов BHS BS 44 BHS 12 20
Бангладеш Народная Республика Бангладеш BGD BD 50 BGD 16 23
Бахрейн Королевство Бахрейн BHR BH 48 BHR 13 21
Барбадос Барбадос BRB BB 52 BRB 14 24
Беларусь Республика Беларусь BLR BY 112 BLR 57 26
Белиз Белиз BLZ BZ 84 BLZ 23 28
Бельгия Королевство Бельгия BEL BE 56 BEL 255 27
Бенин Республика Бенин BEN BJ 204 BEN 53 29
Болгария Республика Болгария BGR BG 100 BGR 27 41
Боливия (Многонациональное Государство) Многонациональное Государство Боливия BOL BO 68 BOL 19 33
Босния и Герцеговина Босния и Герцеговина BIH BA 70 BIH 80 34
Ботсвана Республика Ботсвана BWA BW 72 BWA 20 35
Бутан Королевство Бутан BTN BT 64 BTN 18 31
Буркина-Фасо Буркина-Фасо BFA BF 854 BFA 233 42
Бурунди Республика Бурунди BDI BI 108 BDI 29 43
Бразилия Федеративная Республика Бразилия BRA BR 76 BRA 21 37
Бруней-Даруссалам Бруней-Даруссалам BRN BN 96 BRN 26 40
Вануату Республика Вануату VUT VU 548 VUT 155 262
Венгрия Венгрия HUN HU 348 HUN 97 113
Венесуэла (Боливарианская Республика) Боливарианская Республика Венесуэла VEN VE 862 VEN 236 263
Вьетнам Социалистическая Республика Вьетнам VNM VN 704 VNM 237 264
Габон Габонская Республика GAB GA 266 GAB 74 89
Гаити Республика Гаити HTI HT 332 HTI 93 108
Гайана Кооперативная Республика Гайана GUY GY 328 GUY 91 107
Гамбия Республика Гамбия GMB GM 270 GMB 75 90
Гана Республика Гана GHA GH 288 GHA 81 94
Гватемала Республика Гватемала GTM GT 320 GTM 89 103
Гвинея Гвинейская Республика GIN GN 324 GIN 90 106
Гвинея-Бисау Республика Гвинея-Бисау GNB GW 624 GNB 175 105
Германия Федеративная Республика Германия DEU DE 276 DEU 79 93
Гондурас Республика Гондурас HND HN 340 HND 95 111
Гренада Гренада GRD GD 308 GRD 86 99
Греция Греческая Республика GRC GR 300 GRC 84 97
Грузия Грузия GEO GE 268 GEO 73 92
Дания Королевство Дания DNK DK 208 DNK 54 69
Демократическая Республика Конго Демократическая Республика Конго COD CD 180 COD 250 68
Джибути Республика Джибути DJI DJ 262 DJI 72 70
Доминика Содружество Доминики DMA DM 212 DMA 55 71
Доминиканская Республика Доминиканская Республика DOM DO 214 DOM 56 72
Египет Арабская Республика Египет EGY EG 818 EGY 59 40765
Лаосская Народно-Демократическая Республика Лаосская Народно-Демократическая Республика LAO LA 418 LAO 120 139
Латвия Латвийская Республика LVA LV 428 LVA 119 140
Лесото Королевство Лесото LSO LS 426 LSO 122 142
Либерия Республика Либерия LBR LR 430 LBR 123 144
Ливан Ливанская Республика LBN LB 422 LBN 121 141
Ливия Государство Ливия LBY LY 434 LBY 124 145
Литва Литовская Республика LTU LT 440 LTU 126 147
Люксембург Великое Герцогство Люксембург LUX LU 442 LUX 256 148
Йемен Йеменская Республика YEM YE 887 YEM 249 269

уязвимостей для жестокого обращения среди женщин с ограниченными возможностями

  • Эндрюс, А. Б., и Веронен, Л.Дж. (1993). Сексуальное насилие и инвалиды. Специальный выпуск: Сексуальность и инвалидность: руководство для работников сферы социальных услуг. Журнал социальной работы и сексуальности человека , 8 (2), 137-159.

    Google ученый

  • Бельский Дж. (1980). Жестокое обращение с детьми: экологическая интеграция. Американский психолог , 35 (4), 320-335.

    Google ученый

  • Claussen, A.H., & Crittenden, P.M. (1991). Жестокое обращение с физическим и психологическим здоровьем: отношения между видами жестокого обращения. Жестокое обращение с детьми и пренебрежение , 15 , 5-18.

    Google ученый

  • Коул, С.С. (1984). Столкновение с проблемами сексуального насилия в отношении людей с ограниченными возможностями. Сексуальность и инвалидность , 7 (3/4), 71-88.

    Google ученый

  • Данек М.М. (1992). Еще раз о статусе женщин с ограниченными возможностями. Журнал прикладного реабилитационного консультирования , 23 (4), 7-13.

    Google ученый

  • Фармер А. и Тифенталер Дж. (1996). Домашнее насилие: ценность услуг как сигналов. Американский экономический обзор , 86 (2), 274-279.

    Google ученый

  • Файн, М., & Аш, А. (ред.) (1988). Женщины с ограниченными возможностями: очерки психологии, культуры и политики . Филадельфия, Пенсильвания: издательство Temple University Press.

    Google ученый

  • Финкельхор, Д., и Корбин, Дж. (1988). Жестокое обращение с детьми как международная проблема. Жестокое обращение с детьми и пренебрежение , 12 , 3-23.

    Google ученый

  • Глейзер, Б. Г., и Штраус, А.Л. (1967). Открытие обоснованной теории: стратегии качественного исследования . Нью-Йорк: Издательство Aldine.

    Google ученый

  • Хоуленд, К.А., Носек, М.А., и Янг, М.Е. (2001). Программы по оказанию помощи женщинам с ограниченными возможностями по вмешательству в жестокое обращение.ТОЛПА: Хьюстон.

    Google ученый

  • Макфарлейн, Дж., Хьюз, Р. Б., Носек, М. А., Грофф, Дж. Ю., Сведлунд, Н., и Маллен, П. Д. (2001). Экран оценки жестокого обращения — инвалидность (AAS-D): определение частоты, типа и виновника жестокого обращения с женщинами с физическими недостатками. Журнал женского здоровья и гендерной медицины, 10 (9).

  • Мерфи, П.А. (1993). Установление связей: женщины, работа и насилие .Орландо, Флорида: Paul M. Deutsch Press, Inc.

    Google ученый

  • Мерфи, П. А. (1992). Изучение истории злоупотреблений при первоначальной оценке. НАРППС , 7 (5), 187-190.

    Google ученый

  • Носек, М.А. (1995). Сексуальное насилие над женщинами с ограниченными физическими возможностями. Физическая медицина и реабилитация: современные обзоры , 9 (2), 487-502.

    Google ученый

  • Носек, М.А. (1996). Сексуальное насилие над женщинами с ограниченными физическими возможностями. В D.M. Кротоски, М. А. Носек и М. А. Тюрк (ред.), Женщины с ограниченными физическими возможностями: достижение и поддержание здоровья и благополучия (стр. 153-173). Балтимор, Мэриленд: Пол Х. Брукс.

    Google ученый

  • Носек, М.А., Хоуленд, К.А., и Янг, М.Э. (1997). Жестокое обращение с женщинами с ограниченными возможностями: последствия для политики. Журнал исследований политики в области инвалидности , 8 (1-2), 157-176.

    Google ученый

  • Университет Рутгерса, Бюро экономических исследований и Всемирный институт инвалидности (без даты). На пути к пониманию потребности в персональной помощи . Нью-Брансуик, Нью-Джерси: Рутгерс.

  • Schaller, J., & Fieberg J.Л. (1998). Проблемы жестокого обращения с женщинами с ограниченными возможностями и последствия для реабилитационного консультирования. Журнал прикладного реабилитационного консультирования , 29 (2): 9-17.

    Google ученый

  • Соекен К., Макфарлейн Дж., Паркер Б. и Кэмпбелл Дж. К. (1997). Экран оценки жестокого обращения: клинический инструмент для измерения частоты, серьезности и виновников жестокого обращения с женщинами. In Soeken, K., McFarlane, J., Паркер, Б. и Кэмпбелл, Дж. К. Помимо диагноза: защита здоровья женщин и их детей, подвергшихся побоям . Таузенд-Оукс, Калифорния: Сейдж.

    Google ученый

  • Бюро переписи населения США. (1989). Статус рабочей силы и другие характеристики лиц с нетрудоспособностью: 1981–1988 гг. (Серия текущих демографических отчетов P-23, № 160) . Вашингтон, округ Колумбия: Типография правительства США.

    Google ученый

  • Жендез, К., И Шнайдерман К. (1991). Спасение от жестокого обращения: уникальные проблемы для женщин с ограниченными возможностями. Сексуальность и инвалидность , 9 (3), 273-280.

    Google ученый

  • Сом-голиаф, нерестящийся в далекой западной части Амазонки, подтвержден распределением взрослых взрослых особей, дрейфующих личинок и мигрирующей молоди

  • 1

    Бартхем, Р. и Гулдинг, М. Неожиданная экосистема: Амазонка, выявленная промысловыми предприятиями .(Графика Библос и Ботанический сад Миссури, 2007).

  • 2

    Гулдинг, М. В тропических лесах: разнообразие и сохранение (ред. Ф. Альмеда и К. М. Прингл) 71–86 (Калифорнийская академия наук, 1988).

  • 3

    Араухо-Лима, Карм и Руффино, М.Л. В мигрирующих рыб Южной Америки: биология, промысел и состояние сохранения (ред. Дж. Кэролсфилд, Б. Харви, К. Росс и А. Баер) 62–75 (Всемирный фонд рыболовства / Всемирный банк / IDRC, 2004 г.).

  • 4

    Гулдинг, М. Человек и рыболовство на границе Амазонки . 121 (Kluwer Academic Publishers / Springer-Verlag, 1981).

  • 5

    Рибейро, М. К. Л. Б. и Петрере-младший, М. Экология рыболовства и управление хараки (Semaprochilodus taeniurus, S. insignis) в Центральной Амазонии . 5 , 195–215 (1990).

    Google ученый

  • 6

    Родригес-Фернандес, К.А.Багрес, Мальлерос-и-Куэрдерос и Эль-Бахо-Рио-Какета. Estudios en la Amazonía Colombiana . Vol. 2 (Тропенбос-Колумбия, 1991).

  • 7

    Лукас, М. К. и Барас, Э. Миграция пресноводных рыб. 440 (Blackwell Science Ltd, 2001).

  • 8

    Aarestrup, K. et al. Океаническая нерестовая миграция европейского угря ( Anguilla anguilla ). Наука 325 , 1660 (2009).

    CAS ОБЪЯВЛЕНИЯ Статья Google ученый

  • 9

    Бартем, Р.Б. и Гоулдинг М. Связь сома: экология, миграция и сохранение хищников Амазонки . (Издательство Колумбийского университета, 1997).

  • 10

    Duponchelle, F. et al. Трансамазонское натальное самонаведение у гигантского сома. J. Appl. Ecol. , DOI: 10.1111 / 1365-2664.12665 ​​(2016).

  • 11

    Хегг, Дж. К., Джарриццо, Т. и Кеннеди Брайан, П. Разнообразные стратегии раннего жизненного цикла мигрирующих амазонских сомов: значение для сохранения и управления. PLoS ONE 10 (2015).

  • 12

    Герман, Т. В., Стюарт, Д. Дж., Лимбург, К. Э. и Кастелло, Л. Раскрытие истории жизни амазонских рыб с помощью микрохимии отолитов. Королевское общество открытой науки 3 (2016).

  • 13

    Кэролсфельд, Дж., Харви, Б., Росс, К. и Баер, А. (Центр исследований международного развития, Оттава, Канада, 2003 г.).

  • 14

    Cowx, I.G. et al. Vol. 49 (изд. Комиссия по реке Меконг) 100 (Технический документ MRC, Пномпень, 2015 г.).

  • 15

    Хоган, З., Бэрд, И. Г., Радтке, Р., Вандер-Занден, М. Дж. Миграция на большие расстояния и морское обитание у тропических азиатских сомов, Pangasius krempfi. J. Fish. Биол. 71 , 818–832 (2007).

    Артикул Google ученый

  • 16

    Lundberg, J. G. Brachyplatystoma promagdalena , новый вид, ископаемый сом-голиаф (Siluriformes: Pimelodidae) из миоцена Колумбии, Южная Америка. Neotrop. Ихти. 3 , 597–605 (2005).

    Артикул Google ученый

  • 17

    Lundberg, J. G. & Akama, A. Brachyplatystoma capapretum : новый вид сома-голиафа из бассейна Амазонки с реклассификацией родственных сомов (Siluriformes: Pimelodidae). Копея 2005 , 492–516 (2005).

    Артикул Google ученый

  • 18

    Лундберг, Дж.Г., Салливан, Дж. П. и Хардман, М. Филогенетика семейства южноамериканских сомов Pimelodidae (Teleostei: Siluriformes) с использованием последовательностей ядерных и митохондриальных генов. Proc. Акад. Nat. Sci. Филадельфия 161 , 153–189 (2011).

    Артикул Google ученый

  • 19

    Agudelo-Córdoba, E. et al. Разведение, рост и эксплуатация Brachyplatystoma rousseauxii Castelnau, 1855 г. в реке Какета, Колумбия. Neotrop. Ихтиол. 11 , 637–647 (2013).

    Артикул Google ученый

  • 20

    Бартем, Р., Гулдинг, М., Форсберг, Б., Каньяс, К. М. и Ортега, Х. Водная экология Рио-Мадре-де-Диос: научные основы сохранения истоков Андов и Амазонки . (Asociación para La Conseración de La Cuenca Amazónica (ACCA) / Amazon Conservation Association (ACA), 2003).

  • 21

    Коронел, Дж.С., Маес, Г. Э., Клаус, С., Дамм, П. А. В. и Волкаерт, Ф. А. М. Дифференциальная история популяций у мигрирующих сомов Brachyplatystoma flavicans и Pseudoplatystoma fasciatum (Pimelodidae) из боливийских маркеров Амазонки, оцененная с помощью ядерных и митохондриальных маркеров. J. Fish Biol. 65 , 859–868 (2004).

    Артикул Google ученый

  • 22

    Garcia-Vasquez, A. et al.Характеристики жизненного цикла большого амазонского мигрирующего сома Brachyplatystoma rousseauxii в районе Икитос, Перу. J. Fish Biol. 75 , 2527–2551, DOI: 10.1111 / j.1095-8649.2009.02444.x (2009).

    CAS Статья PubMed Google ученый

  • 23

    Лассо, К.А. и др. В серии , редакционные Recursos Hidrobiológicos y Pesqueros Continentales de Colombia . 359 (Институт биологических исследований Александра фон Гумбольдта, Богота, Колумбия, 2011 г. ).

  • 24

    Утрерас-Бучели, В. М. Caracterización de la pesca de grandes bagres en el Alto Río Napo (Эквадор), recomendaciones para su manejo y conservación Магистерская диссертация, Universidad Internacional (UNA Andulucía) (2010).

  • 25

    Нуньес, Дж. И Дюпоншель, Ф. К универсальной шкале для оценки полового созревания и связанных с ним особенностей жизненного цикла яйцекладущих костистых рыб. Рыба. Phys. Biochem. 35 , 167–180 (2009).

    Артикул Google ученый

  • 26

    Мерона, Б.д., Юрас А.А., Сантос Г.М. & Cintra, I.H.A. Os peixes e a pesca no baixo rio Tocantins: Vinte anos depois da UHE Tucuruí . 208p (Centrais Elétricas do Nort e do Brasil S.A — Eletrobr as Eletronort e, 2010).

  • 27

    Barthem, R. B. Ocorrência, distribuição e biologia dos peixes da baía de Marajó, estuário amazônico. Бол. Mus. paraense Emílio Goeldi 2 , 49–69 (1985).

    Google ученый

  • 28

    Каньяс, К.M. La pesca en la provincia de Tambopata: Monitoreo y ordenamiento pesquero en el sureste peruano . 178–186 (Proyecto Aprovechamiento y Manejo Sostenible de la Reserva de Biosfera y Parque Nacional del Manu (PRO-MANU), Лима, Перу, 2000 г.).

  • 29

    Riofrío-Quijandria, J. C. & Palma-Gonzales, C. Evaluación pesquera en Atalaya y alrededores (Ucayali) . (Informe Técnico Presentado ERM, 2003 г.).

  • 30

    Каньяс, К. М. и Пайн, В. Э.Документирование временных и пространственных закономерностей нереста Pimelodidae и расселения личинок в реке Мадре-де-Диос (Перу): идеи для сохранения в верховьях Анд и Амазонки. River Res. Прил. 27 , 602–611, DOI: 10.1002 / rra.1377 (2011).

    Артикул Google ученый

  • 31

    Каньяс, C. Evaluación de los recuros pesqueros en la proviincia de Tambopata, Madre de Dios. Conservation International, Перу, Série Técnica 67 , 1–34 (2000).

    Google ученый

  • 32

    Рикер У. Э. Расчет и интерпретация биологической статистики популяций рыб. Бык. Рыба. Res. Board Canada 191 , 1–382 (1975).

    Google ученый

  • 33

    Очоа, Л. Э. и др. Генетическая структура и историческое разнообразие сома Brachyplatystoma platynemum (Siluriformes: Pimelodidae) в бассейне Амазонки с последствиями для его сохранения. Ecol. Evol. 5 , 2005–2020 (2015).

    Артикул Google ученый

  • 34

    Алонсо, Дж. К. и Пиркер, Л. Э. М. В О Манежу да Песка душ Грандес Багрес Миградорес (ред. Н. Н. Фабре и Р. Б. Бартхем) 21–28 (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis ​​2005).

  • 35

    Кук С.Дж., Кроссин Г.Т. и Хинч С.Г. В энциклопедии физиологии рыб : от генома к окружающей среде Vol.3 (редактор А.П. Фаррелл) 1945–1952 (Academic Press, 2011).

  • 36

    Бартем Р. Б., Рибейро М. и Петрере-младший М. Жизненные стратегии некоторых дальних мигрирующих сомов в отношении плотин гидроэлектростанций в бассейне Амазонки. Biol. Conser. 55 , 339–345 (1991).

    Артикул Google ученый

  • 37

    Клаутау, А.Г.С.М. и др. На биоразнообразие повлиял промышленный лов пирамутабы в устье реки Амазонки. Бол. Inst. Песка 42 , 102–111 (2016).

    Артикул Google ученый

  • 38

    Barthem, RB, Costa, MC, Cassemiro, F., Leite, RG & Silva-Jr., N. In Biodiversity: The Dynamic Balance of the Planet (ed O. Grillo) 137–158 ( InTech, 2014).

  • 39

    Lechner, A. et al. Гидравлические силы воздействуют на дрейф личинок рыб на свободном участке большой европейской реки. Экогидрология 7 , 648–658 (2014).

    Артикул Google ученый

  • 40

    Agudelo-Córdoba, E. et al. Bagres de la Amazonia Colombiana: Un Recurso sin Fronteras . (СИНЧИ, 2000).

  • 41

    García-Dávila, C. et al. Использование штрихового кодирования личинок для исследования сезонов размножения пимелодидных сомов из рек Маранон, Напо и Укаяли в перуанской Амазонии. Дж.Прил. Ихтиол. 31 , 40–51 (2016).

    Артикул Google ученый

  • 42

    Cella-Ribeiro, A. et al. Временное и пространственное распределение молодых Brachyplatystoma spp. (Siluriformes: Pimelodidae) вдоль порогового участка реки Мадейра (Бразилия) до строительства двух плотин гидроэлектростанций. J. Fish Biol. 86 , 1429–1437 (2015).

    CAS Статья Google ученый

  • 43

    Девол, А.Х., Форсберг, Б., Ричи, Дж. И Пиментел, Т. П. Сезонные колебания в химическом распределении в реке Амазонка (Солимоэс): многолетний временной ряд. Глоб. Геохим. Цикл 9 , 307–328 (1995).

    CAS ОБЪЯВЛЕНИЯ Статья Google ученый

  • 44

    Весселинг, Ф. П. и Хорн, К. В Историческая биогеография неотропических пресноводных рыб (редакторы Джеймс Альберт и Роберто Э. Рейс) 59–67 (Калифорнийский университет Press, 2007).

  • 45

    Мачадо-Эллисон, А. В Репродуктивная биология южноамериканских позвоночных 45–59 (Springer, 1992).

  • 46

    Formiga-Aquino, K. et al. В Biología de las Poblaciones de Peces Amazónicos y Piscicultura. Comunicaciones del Segundo Coloquio Internacional de la Red de Investigación sobre la Ictiofauna Amazónica . (редакторы Хесус Нуньес, Фред Чу-Ку, Хорхе Порто и Кармен Р. Гарсия-Давила) 37–46 (IRD) (2011).

  • 47

    Родригес, Ф.С., Фариас, И. П., Батиста, Дж. И Алвес-Гомес, Дж. А. Выделение и характеристика локусов микросателлитов для «пирамутабы» ( Brachyplatystoma vaillantii , Siluriformes: Pimelodidae), одной из самых коммерчески важных мигрирующих сомов в бассейне Амазонки. . Минусы. Gen. Res. 1 , 365–368 (2009).

    Артикул Google ученый

  • 48

    Батиста, Дж. С. и Алвес-Гомес, Дж. А. Филогеография Brachyplatystoma rousseauxii (Siluriformes — Pimelodidae) в бассейне Амазонки предлагает предварительные доказательства первого случая «возвращения в исходное положение» для мигрирующего амазонского сома. Gen. Mol. Res. 5 , 723–740 (2006).

    Google ученый

  • 49

    Карвахаль-Валлехос, Ф. М. и др. Генетическая структура амазонского сома Brachyplatystoma rousseauxii : влияние стратегий жизненного цикла. Genetica 142 , 323–336, DOI: 10.1007 / s10709-014-9777-2 (2014).

    CAS Статья PubMed Google ученый

  • 50

    Бартем, Р.Б. и Швассманн, Х. О. Влияние реки Амазонки на сезонное смещение соляного клина в устье реки Токантинс, Бразилия, 1983–1985 гг. Бол. Mus. пар. Эмилио Гоэльди, Zool. 10 , 119–130 (1994).

    Google ученый

  • 51

    Финер, М. и Дженкинс, К. Н. Распространение плотин гидроэлектростанций в Андах Амазонки и последствия для соединения Анд и Амазонки. PLoS One 7 , e35126, http: // www.ncbi.nlm.nih.gov/pubmed/22529979 (2012).

    CAS ОБЪЯВЛЕНИЯ Статья Google ученый

  • 52

    Финер, М., Дженкинс, К. Н., Пимм, С. Л., Кин, Б. и Росс, К. Нефтегазовые проекты в западной части Амазонки: угрозы дикой природе, биоразнообразию и коренным народам. PloS one 3 , e2932, DOI: 10.1371 / journal.pone.0002932 (2008).

    CAS ОБЪЯВЛЕНИЯ Статья PubMed PubMed Central Google ученый

  • 53

    Гулдинг, М. Рыбы и лес: исследования естественной истории Амазонки . (Калифорнийский университет Press, 1980).

  • 54

    Regarda, V. et al. Геоморфические свидетельства недавнего поднятия Арки Фицкарральда (Перу): ответ на субдукцию хребта Наска . 107 , 107–117 (2009).

    Google ученый

  • 55

    Балон Э. К. Терминология интервалов в развитии рыб. J. Fish.Res. Board Canada 32 , 1663–1670 (1975).

    Артикул Google ученый

  • 56

    Лейте, Р. Г., Каньяс, К., Форсберг, Б., Бартхем, Р. и Гулдинг, М. Larvas dos Grandes Bagres Migradores . 127 (Instituto Nacional de Pesquisas da Amazônia / Asociación para la Conservación de la Cuenca Amazónica, 2007).

  • 57

    Каньяс, К. М. и Вейлен, П. Р. Моделирование производства мигрирующих личинок сома (Pimelodidae) на основе региональных гидроклиматологических особенностей бассейна Мадре-де-Диос на юго-востоке Перу. Hydrol. Процессы 26 , 996–1007, DOI: 10.1002 / hyp.8192 (2012).

    ADS Статья Google ученый

  • Значение экспрессии p16ink4a в опухолях

    Cell Cycle. 1 августа 2011 г .; 10 (15): 2497–2503.

    Функциональное значение, клинические ассоциации и будущие разработки

    , 1 , 2 , 1 , 3 , 4 , 5 , 1 , 5 и 1 , 3 , *

    Агнешка К.Виткевич

    1 Онкологический центр Киммеля; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    2 Отделение патологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    Карен Э. Кнудсен

    1 Онкологический центр Киммеля; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    3 Департамент клеточной биологии и биологии рака; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    4 Отделение урологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    5 Отделение радиационной онкологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    Адам П.Дикер

    1 Онкологический центр Киммела; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    5 Отделение радиационной онкологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    Эрик С. Кнудсен

    1 Онкологический центр Киммела; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    3 Департамент клеточной биологии и биологии рака; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    1 Онкологический центр Киммела; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    2 Отделение патологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    3 Департамент клеточной биологии и биологии рака; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    4 Отделение урологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    5 Отделение радиационной онкологии; Университет Томаса Джефферсона; Филадельфия, Пенсильвания, США

    Получено 2 июня 2011 г .; Пересмотрено 13 июня 2011 г .; Принята в печать 13 июня 2011 г.

    Эта статья цитируется в других статьях в PMC.

    Abstract

    Ген CDKN2A является супрессором опухоли, который кодирует ингибитор CDK4 / 6 p16 ink4a . Утрата этого опухолевого супрессора способствует обходу критических сигналов старения и связана с прогрессированием до злокачественного заболевания. Однако высокий уровень экспрессии p16 ink4a в опухолях связан с агрессивными подтипами заболевания, и в некоторых клинических условиях повышенная экспрессия p16 ink4a является важным детерминантом для прогноза заболевания и терапевтического ответа.Эти, казалось бы, противоречивые аспекты экспрессии p16 ink4a привели к путанице, связанной со значением этого подавления опухоли в патобиологии опухолей. Как рассмотрено здесь, альтернативная экспрессия p16 ink4a представляет собой идеальный маркер для рассмотрения функции пути RB, гетерогенности опухоли и новых средств для направления терапии.

    Ключевые слова: RB, p16, CDKN2a, E2F, CDK, циклин, терапия, облучение

    p16

    ink4a и Cell Cycle Control

    Белок p16 ink4a был идентифицирован как белок с низкой молекулярной массой, связанный с циклином. зависимые киназы 4 и 6 (CDK4 и CDK6). 1 , 2 Этой биохимической характеристике в значительной степени способствовало открытие, что в опухолевых клетках, трансформированных SV40, единственная обнаруживаемая форма CDK4 находится в комплексе с p16 ink4a . 1 Биохимически связывание p16 ink4a с CDK4 или CDK6 нарушает ассоциацию с циклинами D1, D2 или D3, которые имеют решающее значение для каталитической активности (). 1 3

    Рисунок 1. Схема функции p16 ink4a .

    Прогрессирование клеточного цикла стимулируется митогенными сигналами, которые объединяются при активации активности CDK4 / 6. 4 , 5 Обычно такие сигналы приводят к накоплению циклинов D-типа, 6 облегчают ядерную локализацию циклинов, 7 и образование комплекса с CDK4 / 6 8 (). Этот активный каталитический комплекс инициирует фосфорилирование опухолевого супрессора RB в ранней / средней фазе клеточного цикла G 1 . 9 , 10 Белок RB негативно регулирует активность фактора транскрипции E2F, который контролирует экспрессию генов, необходимых для биосинтеза нуклеотидов (например, дигидрофолатредуктазы, тимидилатсинтазы , синтеза рибуноклеотид-редуктазы (ДНК-редуктазы) например, Cdc6, MCM7, Cyclin A), митотическая прогрессия (например, Plk1, Cyclin B1, Cdk1) и восстановление повреждений ДНК (Rad51, FancA, RPA). 11 14 Индукция этой транскрипционной программы имеет решающее значение для пролиферации клеток.Следовательно, CDK-опосредованное фосфорилирование RB является критическим для последующего прохождения клеточного цикла. 15 , 16 В соответствии с этой концепцией повышенная экспрессия p16 ink4a является мощным механизмом ингибирования пролиферации и доминирует над множеством митогенных и онкогенных сигналов. 17 19 Таким образом, p16 ink4a является особенно мощным эффектором развития клеточного цикла, который действует совместно с CDK4 / Cyclin D и RB в координации пролиферации.

    Рисунок 2. p16 ink4a функционирует для активации RB-зависимой остановки клеточного цикла.

    Нарушение p16

    ink4a и пути RB при раке человека

    Параллельно с идентификацией механизмов, посредством которых p16 ink4a способствовал контролю клеточного цикла, была обнаружена роль в подавлении опухоли. Первоначально было замечено, что ген, кодирующий CDKN2A, был мутирован или заглушен в широком спектре типов опухолей и клеточных линий. 20 , 21 В частности, потеря или эпигенетическое молчание CDKN2A очень часто встречается в клеточных линиях, что позволяет предположить, что процесс культивирования клеток селективен против экспрессии p16 ink4a . Последующий анализ показал, что метилирование локуса CDKN2A является обычным явлением в опухолях и считается ключевой мишенью эпигенетической инактивации. 22 Наконец, люди, несущие скомпрометированные аллели CDKN2A, предрасположены к меланоме. 23 В общем, потеря p16 ink4a была предложена для облегчения аберрантного прогрессирования клеточного цикла, ослабляя важный аспект контроля над прогрессией G 1 / S по пути RB.В соответствии с этой идеей потеря p16 ink4a является взаимоисключающей с потерей RB или амплификацией циклина D1 в данной опухоли. 24 Кроме того, при раке были обнаружены мутации CDK4, которые специфически препятствуют связыванию p16 ink4a . 25 Эти объединенные данные указывают на то, что запрещенная биохимическая функция p16 ink4a через ингибирование CDK4 / 6 имеет решающее значение для подавления опухоли.

    Регулирование p16

    ink4a Экспрессия

    Учитывая важную роль p16 ink4a в ограничении пролиферации, он строго регулируется.В пролиферирующих нормальных тканях экспрессия p16 ink4a обычно низкая. Это открытие согласуется с функцией ингибирования CDK4 / 6, которая должна быть устранена для пролиферации. Однако ряд различных стрессов, включая повреждение ДНК, а также онкогенный стресс и физиологическое старение, могут привести к активации экспрессии p16 ink4a . 26 30 В частности, похоже, что многие события, запускающие процесс клеточного или индуцированного старения, вызывают экспрессию p16 ink4a как критического эффектора для стабильной остановки клеток.Например, в процессе старения наблюдается общая тенденция к повышению уровня p16 ink4a в тканях. Предполагается, что этот механизм имеет решающее значение для ограничения развития опухоли, инициированного онкогенами. 26 Высокие уровни p16 ink4a наблюдаются при некоторых предраковых поражениях, при этом считается, что он способствует остановке прогрессирования поражения. 29 Например, считается, что в невусах экспрессия p16 ink4a индуцируется онкогенной активацией B-Raf. 31 Все эти результаты согласуются с ролью p16 ink4a как супрессора опухоли и ожидаемой потерей во время прогрессирования заболевания.

    Значение повышенного p16

    ink4a в опухоли

    В то время как p16 ink4a явно является супрессором опухоли, аберрантное повышение p16 ink4a наблюдается при ряде раковых заболеваний. Как было установлено при идентификации p16 ink4a , экспрессия вирусных онкопротеинов, в частности, делает возможным развитие трансформированных клеточных популяций, которые экспрессируют обильные уровни p16 ink4a .Соответственно, опухоли человека, вызываемые специфическими онкогенными вирусами, содержат высокие уровни p16 ink4a . Лучший пример этого явления относится к вирусу папилломы человека (ВПЧ), где высокие уровни p16 ink4a являются признаком ВПЧ-положительного рака шейки матки и рака головы и шеи. 32 Причина, по которой такие опухоли образуются с высоким уровнем p16 ink4a , заключается в том, что вирусные онкопротеины нацелены на RB. В контексте HPV белок E7 сильно нарушает функцию RB и приводит к деградации белка. 33 , 34 В соответствии с этой взаимосвязью, опухоли, в которых отсутствует RB другими способами (например, генетическая потеря RB при мелкоклеточном раке легких), несут высокие уровни p16 ink4a . 35 Эта взаимосвязь, по-видимому, является в значительной степени абсолютной и наблюдается действительно во всех линиях опухолевых клеток и образцах пациентов, которые были изучены. Функционально было продемонстрировано, что потеря функции RB позволяет обходить опосредованное p16 ink4a ингибирование клеточного цикла. 18 Однако также было показано, что потеря RB вызывает онкогенный стресс, который может привести к активации экспрессии p16 ink4a . 36 Таким образом, в настоящее время существуют две взаимодополняющие модели для появления опухолей с высоким уровнем p16 ink4a . Во-первых, онкогенные стрессы индуцируют p16 ink4a , что ограничивает онкогенное прогрессирование (). Однако это событие можно обойти, потеряв RB. Таким образом, инактивация RB является вторичным событием после данного онкогенного стресса, которое способствует прогрессированию заболевания.Во-вторых, потеря RB вызывает онкогенный стресс, который индуцирует p16 ink4a (). Поскольку RB уже нарушен, индукция p16 ink4a не может остановить прогрессирование опухоли, и, таким образом, опухоли развиваются с высокими уровнями p16 ink4a . Вероятно, что оба механизма задействованы в разных типах опухолей. Например, при ретинобластоме или раке шейки матки потеря RB является частью этиологии заболевания, и, таким образом, индукция p16 ink4a является вторичным явлением.Напротив, в других опухолях, где потеря RB происходит на более позднем этапе болезни, она может представлять собой вторичное событие, способствующее прогрессированию заболевания. Независимо от механизма, предположительно любая опухоль, несущая высокие уровни p16 ink4a , инактивировала RB для облегчения онкогенной пролиферации.

    Рисунок 3. Определенные онкогенные пути, ведущие к индукции p16 ink4a .

    Интерпретация уровней p16

    ink4a

    Очевидно, есть два дискретных связанных с опухолью состояния для p16 ink4a : потеря / молчание опухолевого супрессора и повышенная экспрессия, связанная с потерей функции RB.Следовательно, чрезвычайно важно указать, что «подразумевается» под положительным окрашиванием. В обзоре литературы многие исследования сообщают только о наличии или отсутствии p16 ink4a . Конечно, это можно интерпретировать как опухоль с дефицитом RB по сравнению с опухолью с дефицитом RB (высокая или низкая) или как опухоли, которые фактически потеряли p16 ink4a . Эта загадка, в настоящее время затуманивающая интерпретацию опубликованных работ, связанных с p16 ink4a и исходом заболевания, и, вероятно, является причиной ряда разрозненных выводов в литературе.Как показано на фиг.4, в образцах рака наблюдаются различные уровни окрашивания p16 ink4a . В тех поражениях, которые являются RB-дефицитными, окрашивание p16 ink4a сильно повышено по сравнению с контрольной нормальной тканью. Напротив, другие опухоли демонстрируют потерю p16 ink4a . Между этими двумя крайностями есть опухоли, которые поддерживают уровни p16 ink4a , которые в значительной степени соответствуют ткани происхождения. Как обсуждается ниже, хотя это обеспечивает важную контрольную точку для рассмотрения статуса p16 ink4a в опухолях, использование дополнительных маркеров важно для окончательного исследования функционального статуса пути p16 ink4a / RB в отношении биологии опухоли.

    Рис. 4. Типичное окрашивание для p16 ink4a и Ki67. (A) Высокая экспрессия p16 в TNBC, 200x. (B) Высокий индекс пролиферации ki67 в TNBC, 200x. (C) Отсутствие экспрессии p16 в злокачественных железах карциномы поджелудочной железы с очаговым слабым окрашиванием, присутствующим в строме (200x). (D) Высокий индекс пролиферации ki67 при аденокарциноме протока поджелудочной железы, 200x.

    Прогностические особенности p16

    ink4a в опухолях

    Учитывая центральную роль оси p16 ink4a / RB в координации клеточного цикла, неудивительно, что изменения этого пути наблюдаются в ряде предраковых поражений.В этом контексте такие изменения могут быть связаны с определенным прогнозом, который изменяется тканью происхождения и природой возникающего онкогенного события. В ряде типов опухолей, которые инициируются активацией K-Ras или B-Raf, потеря p16 ink4a имеет решающее значение для развития рака. Таким образом, при таких заболеваниях, как рак поджелудочной железы или меланома, потеря p16 ink4a является относительно частым явлением. 37 Например, при интраэпителиальной неоплазии поджелудочной железы (PanIN), четко определенном предшественнике инвазивной карциномы поджелудочной железы, генетическая потеря или эпигенетическое молчание p16 ink4a следует за мутациями KRAS и напрямую связано с прогрессированием инвазивного заболевания. 38 Было высказано предположение, что потеря p16 ink4a связана с мощным отбором для обхода старения, которое якобы инициируется онкогенным инсультом. 29 , 39 , 40 Напротив, протоковая карцинома молочной железы in situ и межэпителиальная неоплазия предстательной железы могут проявлять сверхэкспрессию p16 ink4a . 41 , 42 Это событие, вероятно, связано с нарушением функции RB в таких поражениях, и быстро пролиферирующие p16 ink4a положительные поражения имеют повышенный риск прогрессирования до инвазивного заболевания. 41 Интересно, что в таких опухолях существует критическое различие между теми, у которых p16 ink4a подавляет пролиферацию предшественников поражений, и теми, у которых это влияние на супрессию опухоли обходится, предположительно из-за нарушения функции RB. 41 Таким образом, для соответствующей интерпретации «значения» повышенной экспрессии p16 ink4a необходимы вспомогательные маркеры (например, маркер пролиферации Ki67) для определения функционального состояния пути.

    Не только экспрессия p16 ink4a неоднородна для разных видов рака, но в рамках данного рака можно использовать уровень p16 ink4a как средство для классификации определенных подтипов рака. Эта возможность наиболее очевидна в контексте мелкоклеточного рака легкого, который характеризуется высокими уровнями p16 ink4a по сравнению с аденокарциномой легкого с низкими уровнями p16 ink4a . 43 , 44 Хотя это гистологически разные формы заболевания, дискриминационная способность уровней p16 ink4a также важна для определения подтипов гистологически неразличимого заболевания.Например, при раке головы и шеи люди с конкретной вирусной этиологией могут быть определены по уровням p16 ink4a и представляют собой конкретное клиническое проявление заболевания. 32 Точно так же базальный рак молочной железы часто характеризуется повышенными уровнями p16 ink4a , и даже как единственный маркер может быть полезен для определения этих опухолей от других подтипов рака молочной железы. 45 Хотя этот подход не был тщательно проанализирован для различных типов опухолей, есть данные, что эти опухоли, содержащие повышенный p16 ink4a , являются очень агрессивными и представляют опухоли, которые инактивировали опухолевый супрессор RB.Удивительно, но, несмотря на эти доказательства, механизм, посредством которого функция RB фактически теряется в таких опухолях, остается неясным. Эти объединенные результаты предполагают, что уровни p16 ink4a могут быть особенно информативными для расшифровки подтипов заболевания, которые могут иметь существенно различное течение заболевания и этиологию опухоли.

    p16

    ink4a и реакция на радиацию / химиотерапию

    То, что различные уровни p16 ink4a возникают при раке, неопровержимо; однако значение этого для клинического ведения заболевания и выбора наиболее подходящих средств лечения такого рака остается проблемой.В частности, экспрессия p16 ink4a широко исследовалась в контексте рака шейки матки и рака головы и шеи. При раке шейки матки большинство опухолей являются HPV-положительными (~ 90%) и имеют повышенный уровень p16 ink4a . Поскольку существует очень мало опухолей, которые демонстрируют низкую экспрессию p16 ink4a , никакой значимой информации, относящейся к предпочтительному лечению, не появилось. Однако при раке головы и шеи ~ 50% имеют повышенные уровни p16 ink4a .Поразительно, что те опухоли, которые демонстрируют высокие уровни p16 ink4a , демонстрируют улучшенный ответ на лучевую терапию. 46 48 Интересно, что даже опухоли, которые являются HPV-отрицательными, но демонстрируют высокую экспрессию p16 ink4a , связаны с улучшенным терапевтическим ответом. 49 Причина этого полностью не известна, хотя многочисленные доклинические модели показали, что нарушение функции RB делает клетки и опухоли чувствительными к цитотоксической терапии, 50 , 51 и, возможно, как HPV, так и соматическая потеря RB возникают при раке головы и шеи, что приводит к повышенной чувствительности к лучевой терапии.Важно отметить, что эти результаты были обобщены в нескольких различных когортах и ​​предполагают, что статус p16 ink4a может быть использован проспективно для определения рака головы и шеи, который будет демонстрировать улучшенную реакцию на радиацию. При других формах рака участие уровней p16 ink4a в ответе на лучевую терапию или химиотерапию менее точно установлено, но в литературе есть наводящие на размышления данные. Например, при раке простаты повышенная экспрессия p16 ink4a была связана с улучшенным ответом на облучение. 52 В совокупности эти данные позволяют предположить, что повышенные уровни p16 ink4a могут быть относительно общим детерминантом улучшенного ответа на лучевую или химиотерапию. Конечно, есть некоторые очень важные оговорки, которые следует учитывать. Например, опухоли, такие как мелкоклеточный рак легкого, которые обладают высокой экспрессией p16 ink4a , действительно хорошо реагируют на химиотерапию первой линии; тем не менее, агрессивный рецидив и развитие резистентности к терапии являются ключевыми особенностями этого заболевания. 53 Таким образом, хотя повышенный p16 ink4a , возможно, может обозначать опухоли, которые будут реагировать на лучевую или химиотерапию, это не всегда означает длительный терапевтический ответ или выживание ().

    Рис. 5. Модель для дифференциального воздействия повышенного p16 ink4a на терапевтический ответ.

    Возникающая значимость p16

    ink4a в ответе на таргетную терапию

    Роль уровней p16 ink4a в ответе на таргетную терапию изучена лишь частично, хотя есть веские основания рассматривать его как значимый маркер для множества агентов, находящихся в клиническом использовании и разработке.Существующий анализ случаев рака молочной железы показал, что высокие уровни p16 ink4a при ER-положительном раке молочной железы связаны с фенотипом просвета B, который показывает больше неудач при эндокринной терапии и преимуществ от цитотоксической химиотерапии. 54 Столь же высокие уровни p16 ink4a связаны с неэффективностью андрогенной терапии, применяемой при лечении рака простаты. 55 Эти комбинированные результаты полностью согласуются с функциональными анализами, которые продемонстрировали, что потеря функции пути RB связана с устойчивостью к этим обычно используемым гормональным препаратам. 56 , 57

    Хотя мало что известно о влиянии уровней p16 ink4a на другие молекулярно-целевые методы лечения в клинических условиях, высокие уровни p16 ink4a могут указывать на плохой ответ. к любому агенту, который действует через цитостатические механизмы, которые препятствуют контролю клеточного цикла G 1 / S (). Основная причина этого заключается в том, что опухолевые клетки с высоким уровнем p16 ink4a и соответствующей потерей функции RB не могут эффективно блокироваться в G 1 .Это было продемонстрировано несколькими лабораториями, использовавшими множество агентов в доклинических моделях. 50 , 51 На самом деле, хотя исследования, опубликованные много лет назад, казались далекими от клинического опыта, теперь они имеют большое значение при рассмотрении вопроса о лечении пациентов. Например, работа, первоначально опубликованная в лаборатории Криса Маршалла по моделям фибробластов, предполагает, что функциональный путь RB необходим для ответа на ингибирование пути Raf / Mek / Erk. 58 Теперь, когда в клинической практике используются узконаправленные соединения, противодействующие этому пути, было бы разумно рассмотреть повышенный уровень p16 ink4a при стратификации пациентов.Наиболее очевидное клиническое пространство для использования повышенных уровней p16 ink4a для включения / исключения пациентов — это ингибиторы CDK4 / 6. В отличие от флавопиридола или других соединений, ингибирующих CDK первого поколения, недавно разработанные ингибиторы CDK4 / 6 (например, PD-0332991) высокоспецифичны для интактного пути RB. 59 Эта концепция была продемонстрирована в нескольких доклинических исследованиях, в которых p16 ink4a high и потеря RB специфически связаны с терапевтическим обходным анастомозом. 60 62 Предположительно, в любой опухоли с повышенным p16 ink4a CDK4 / 6 уже подавлен; таким образом, практически отсутствует вероятность положительного ответа на такие ингибиторы для данной опухоли. Подобная стратификация может иметь решающее значение для широкого спектра таргетных терапий, которые задействуют аппарат клеточного цикла для цитостатического эффекта на прогрессирование заболевания (). Вместе эти результаты иллюстрируют широкую ассоциацию уровней экспрессии p16 ink4a с терапевтическим ответом и подчеркивают потенциальную полезность использования анализа p16 ink4a для терапевтического расслоения.

    Рассмотрение на будущее

    Работа над тем, как использовать совокупную информацию о p16 ink4a для улучшения лечения рака, еще не завершена. Очевидно, что уровни p16 ink4a следует учитывать при использовании цитостатических агентов и, в частности, ингибиторов CDK4 / 6. Однако строгие подходы к оценке и комбинации нескольких маркеров будут иметь решающее значение для использования такой информации в контексте индивидуальной терапии. Конечно, наблюдаемый улучшенный терапевтический ответ при химиотерапии и лучевой терапии предполагает, что такие цитотоксические стратегии могут представлять собой разумный курс действий для опухолей, которые, как считается, имеют повышенную экспрессию p16 ink4a .Однако из-за способности таких опухолей развиваться до устойчивости к терапии и побочных эффектов такой терапии было бы идеально определить новые методы лечения, которые конкретно нацелены на опухоли, отмеченные повышенным p16 ink4a . В частности, синтетические летальные подходы в модельных системах недавно определили новые пути, которые могут специфически воздействовать на те опухоли, несущие дерегуляцию пути p16 / RB. Таким образом, в то время как p16 ink4a является привлекательным маркером для прогноза и терапевтического ответа в клинике, для эффективного использования этой информации в лечении заболевания потребуются серьезные исследования.

    Благодарности

    Авторы благодарят г-жу Элизабет Шаде за помощь в редактировании и создание графики для этой статьи. Доктор А.К. МакКлендон и г-жа Д. Риваденейра также внесли свой вклад в подготовку рукописи.

    Ссылки

    1. Xiong Y, Zhang H, Beach D. Перестройка субъединиц циклин-зависимых киназ связана с клеточной трансформацией. Genes Dev. 1993; 7: 1572–83. DOI: 10.1101 / gad.7.8.1572. [PubMed] [CrossRef] [Google Scholar] 2.Серрано М., Хэннон Г.Дж., Бич Д. Новый регуляторный мотив в контроле клеточного цикла, вызывающий специфическое ингибирование циклина D / CDK4. Природа. 1993; 366: 704–7. DOI: 10.1038 / 366704a0. [PubMed] [CrossRef] [Google Scholar] 3. Руссо А.А., Тонг Л., Ли Джо, Джеффри П.Д., Павлетич Н.П. Структурная основа ингибирования циклин-зависимой киназы Cdk6 опухолевым супрессором p16 INK4a . Природа. 1998. 395: 237–43. DOI: 10,1038 / 26155. [PubMed] [CrossRef] [Google Scholar] 4. Шерр СиДжей. Контроль клеточного цикла и рак.Харви Лект. 2000-2001; 96: 73–92. [PubMed] [Google Scholar] 5. Шерр CJ, Робертс JM. Ингибиторы CDK: положительные и отрицательные регуляторы прогрессирования фазы G 1 . Genes Dev. 1999; 13: 1501–12. DOI: 10.1101 / gad.13.12.1501. [PubMed] [CrossRef] [Google Scholar] 6. Шер CJ, Matsushime H, Roussel MF. Регулирование генов CYL / циклина D колониестимулирующим фактором 1. Ciba Found Symp. 1992; 170: 209–19, обсуждение 219–26. [PubMed] [Google Scholar] 7. Дил Дж.А., Ченг М., Руссель М.Ф., Шерр С.Дж. Киназа-3бета гликоген-синтазы регулирует протеолиз циклина D1 и субклеточную локализацию.Genes Dev. 1998; 12: 3499–511. DOI: 10.1101 / gad.12.22.3499. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Ченг М., Сексл В., Шерр С.Дж., Руссель М.Ф. Сборка циклин D-зависимой киназы и титрование p27 Kip1 , регулируемое митоген-активируемой протеинкиназой киназой (MEK1) Proc Natl Acad Sci U S. A. 1998; 95: 1091-6. DOI: 10.1073 / pnas.95.3.1091. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Като Дж., Мацусимэ Х., Хиберт С.В., Юэн М.Э., Шерр СиДжей. Прямое связывание циклина D с продуктом гена ретинобластомы (pRb) и фосфорилирование pRb с помощью циклин D-зависимой киназы CDK4.Genes Dev. 1993; 7: 331–42. DOI: 10.1101 / gad.7.3.331. [PubMed] [CrossRef] [Google Scholar] 10. Matsushime H, Ewen ME, Strom DK, Kato JY, Hanks SK, Roussel MF и др. Идентификация и свойства атипичной каталитической субъединицы (p34PSK-J3 / cdk4) для млекопитающих D типа G 1 циклинов. Клетка. 1992; 71: 323–34. DOI: 10.1016 / 0092-8674 (92)
  • -O. [PubMed] [CrossRef] [Google Scholar] 11. Кнудсен Э.С., Кнудсен К.Э. Супрессор опухоли ретинобластомы: где рак встречается с клеточным циклом. Exp Biol Med (Maywood) 2006; 231: 1271–81.[PubMed] [Google Scholar] 13. Моррис Э.Дж., Дайсон, штат Нью-Джерси. Белковые партнеры ретинобластомы. Adv Cancer Res. 2001; 82: 1–54. DOI: 10.1016 / S0065-230X (01) 82001-7. [PubMed] [CrossRef] [Google Scholar] 15. Knudsen ES, Wang JY. Двойные механизмы ингибирования связывания E2F с RB посредством циклин-зависимого фосфорилирования RB, опосредованного киназой. Mol Cell Biol. 1997; 17: 5771–83. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Кнудсен Е.С., Бакмастер С., Чен Т.Т., Ферамиско-младший, Ван Дж. Ингибирование синтеза ДНК с помощью RB: влияние на переход G 1 / S и прогрессию S-фазы.Genes Dev. 1998; 12: 2278–92. DOI: 10.1101 / gad.12.15.2278. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Медема Р.Х., Эррера Р.Э., Лам Ф., Вайнберг Р.А. Подавление роста с помощью p16 ink4 требует функционального белка ретинобластомы. Proc Natl Acad Sci U S. A. 1995; 92: 6289–93. DOI: 10.1073 / pnas.92.14.6289. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Лукас Дж., Парри Д., Агард Л., Манн Д. Д., Барткова Дж., Штраус М. и др. Зависимое от белка ретинобластомы ингибирование клеточного цикла опухолевым супрессором p16.Природа. 1995; 375: 503–6. DOI: 10.1038 / 375503a0. [PubMed] [CrossRef] [Google Scholar] 19. Чиен В.В., Доменек С., Каталло Р., Саллес Г., Френч М. Удлинение S-фазы, индуцированное сверхэкспрессией p16 (INK4a) в злокачественных клетках с pRb и p53 дикого типа. Клеточный цикл. 2010; 9: 3286–96. DOI: 10.4161 / cc.9.16.12600. [PubMed] [CrossRef] [Google Scholar] 20. Нобори Т., Миура К., Ву DJ, Лоис А., Такабаяши К., Карсон Д.А. Делеции гена ингибитора циклин-зависимой киназы-4 при множественных раковых заболеваниях человека. Природа. 1994; 368: 753–6.DOI: 10.1038 / 368753a0. [PubMed] [CrossRef] [Google Scholar] 21. Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV и др. Регулятор клеточного цикла, потенциально участвующий в возникновении многих типов опухолей. Наука. 1994; 264: 436–40. DOI: 10.1126 / science.8153634. [PubMed] [CrossRef] [Google Scholar] 22. Лиггетт WH, младший, Сидранский Д. Роль гена супрессора опухоли p16 при раке. J Clin Oncol. 1998. 16: 1197–206. [PubMed] [Google Scholar] 23. Ranade K, Hussussian CJ, Sikorski RS, Varmus HE, Goldstein AM, Tucker MA и др.Мутации, связанные с семейной меланомой, нарушают функцию p16 INK4 . Нат Жене. 1995; 10: 114–6. DOI: 10.1038 / NG0595-114. [PubMed] [CrossRef] [Google Scholar] 24. Aagaard L, Lukas J, Bartkova J, Kjerulff AA, Strauss M, Bartek J. Аберрации p16 Ink4 и гены-супрессоры ретинобластомы встречаются в различных подгруппах линий раковых клеток человека. Int J Cancer. 1995; 61: 115–20. DOI: 10.1002 / ijc.20120. [PubMed] [CrossRef] [Google Scholar] 25. Wölfel T, Hauer M, Schneider J, Serrano M, Wölfel C, Klehmann-Hieb E, et al.Мутант CDK4, нечувствительный к p16 INK4a , нацелен на цитолитические Т-лимфоциты в меланоме человека. Наука. 1995; 269: 1281–4. DOI: 10.1126 / science.7652577. [PubMed] [CrossRef] [Google Scholar] 26. Барткова Дж., Резаи Н., Лионтос М., Каракайдос П., Клецас Д., Исаева Н. и др. Вызванное онкогеном старение является частью барьера туморогенеза, налагаемого контрольными точками повреждения ДНК. Природа. 2006; 444: 633–7. DOI: 10,1038 / природа05268. [PubMed] [CrossRef] [Google Scholar] 27. Ресслер С., Барткова Дж., Нидереггер Х., Бартек Дж., Шарффеттер-Кочанек К., Янсен-Дюрр П. и др.p16 INK4A — надежный биомаркер клеточного старения кожи человека in vivo. Ячейка старения. 2006; 5: 379–89. DOI: 10.1111 / j.1474-9726.2006.00231.x. [PubMed] [CrossRef] [Google Scholar] 28. Серрано М., Лин А.В., МакКеррах М.Э., Бич Д., Лоу, SW. Онкогенный ras вызывает преждевременное старение клеток, связанное с накоплением p53 и p16 INK4a . Клетка. 1997; 88: 593–602. DOI: 10.1016 / S0092-8674 (00) 81902-9. [PubMed] [CrossRef] [Google Scholar] 29. Колладо М., Гил Дж., Эфеян А., Герра С., Шухмахер А. Дж., Баррадас М. и др.Биология опухоли: старение в предраковых опухолях. Природа. 2005; 436: 642. DOI: 10.1038 / 436642a. [PubMed] [CrossRef] [Google Scholar] 30. de Jonge HJ, Woolthuis CM, de Bont ES, Huls G. Парадоксальное подавление мРНК p16 с возрастом при остром миелоидном лейкозе. Старение (Олбани, Нью-Йорк, Интернет) 2009; 1: 949–53. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31. Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T., van der Horst CM, et al. Связанная с BRAFE600 остановка клеточного цикла невусов человека, похожая на старение.Природа. 2005; 436: 720–4. DOI: 10,1038 / природа03890. [PubMed] [CrossRef] [Google Scholar] 32. Менденхолл WM, Логан Х.Л. Вирус папилломы человека и рак головы и шеи. Am J Clin Oncol. 2009; 32: 535–9. DOI: 10.1097 / COC.0b013e31818b8fee. [PubMed] [CrossRef] [Google Scholar] 33. Дайсон Н., Хоули П.М., Мюнгер К., Харлоу Э. Онкопротеин Е7 вируса папилломы человека-16 способен связываться с продуктом гена ретинобластомы. Наука. 1989; 243: 934–7. DOI: 10.1126 / science.2537532. [PubMed] [CrossRef] [Google Scholar] 34. Мюнгер К., Вернесс Б.А., Дайсон Н., Фелпс В.С., Харлоу Е., Хоули П.М.Комплексообразование белков E7 вируса папилломы человека с продуктом гена-супрессора опухоли ретинобластомы. EMBO J. 1989; 8: 4099–105. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35. Келли MJ, Накагава K, Steinberg SM, Mulshine JL, Kamb A, Johnson BE. Дифференциальная инактивация CDKN2 и белка Rb в клеточных линиях немелкоклеточного и мелкоклеточного рака легкого. J Natl Cancer Inst. 1995. 87: 756–61. DOI: 10.1093 / jnci / 87.10.756. [PubMed] [CrossRef] [Google Scholar] 36. Торт Ф., Барткова Дж., Сехестед М., Орнтофт Т., Лукас Дж., Бартек Дж.Дефекты пути ретинобластомы демонстрируют дифференциальную способность активировать ответ конститутивного повреждения ДНК при онкогенезе человека. Cancer Res. 2006; 66: 10258–63. DOI: 10.1158 / 0008-5472.CAN-06-2178. [PubMed] [CrossRef] [Google Scholar] 37. Пуиг С., Мальвехи Дж., Баденас С., Руис А., Хименес Д., Куэльяр Ф. и др. Роль локуса CDKN2A у пациентов с множественными первичными меланомами. J Clin Oncol. 2005; 23: 3043–51. DOI: 10.1200 / JCO.2005.08.034. [PubMed] [CrossRef] [Google Scholar] 38. Hruban RH, Goggins M, Parsons J, Kern SE.Модель прогрессирования рака поджелудочной железы. Clin Cancer Res. 2000; 6: 2969–72. [PubMed] [Google Scholar] 39. Dhomen N, Reis-Filho JS, da Rocha Dias S, Hayward R, Savage K, Delmas V и др. Онкогенный Braf вызывает старение меланоцитов и меланому у мышей. Раковая клетка. 2009; 15: 294–303. DOI: 10.1016 / j.ccr.2009.02.022. [PubMed] [CrossRef] [Google Scholar] 40. Кампизи Дж. Подавление рака: важность старения. Наука. 2005; 309: 886–7. DOI: 10.1126 / science.1116801. [PubMed] [CrossRef] [Google Scholar] 41.Готье М.Л., Берман Х.К., Миллер С., Козакейвич К., Чу К., Мур Д. и др. Отмененный ответ на клеточный стресс позволяет идентифицировать DCIS, связанный с последующими опухолевыми событиями, и определяет базальные опухоли молочной железы. Раковая клетка. 2007; 12: 479–91. DOI: 10.1016 / j.ccr.2007.10.017. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Хеншалл С.М., Куинн Д.И., Ли К.С., главный доктор медицинских наук, Головски Д., Бреннер П.С. и др. Сверхэкспрессия ингибитора клеточного цикла p16 INK4A при интраэпителиальной неоплазии предстательной железы высокой степени предрасполагает к раннему рецидиву у пациентов с раком простаты.Clin Cancer Res. 2001; 7: 544–50. [PubMed] [Google Scholar] 43. Оттерсон Г.А., Кратцке Р.А., Коксон А., Ким Ю.В., Кэй Ф.Дж. Отсутствие белка p16 INK4 ограничено подмножеством линий рака легких, которые сохраняют RB дикого типа. Онкоген. 1994; 9: 3375–8. [PubMed] [Google Scholar] 44. Юань Дж., Кнорр Дж., Альтманнсбергер М., Геккенджан Дж., Ар А., Шарл А. и др. Экспрессия p16 и отсутствие pRB при первичном мелкоклеточном раке легкого. J Pathol. 1999; 189: 358–62. DOI: 10.1002 / (SICI) 1096-9896 (199911) 189: 3 <358 :: AID-PATh552> 3.0.CO; 2-1. [PubMed] [CrossRef] [Google Scholar] 45. Субхавонг А.П., Субхавонг Т., Нассар Х., Куприна Н., Бегум С., Ванг Р. и др. Большинство базальных карцином молочной железы демонстрируют тот же иммунофенотип Rb / p16 + , что и связанные с ВПЧ низкодифференцированные плоскоклеточные карциномы, на которые они похожи морфологически. Am J Surg Pathol. 2009; 33: 163–75. DOI: 10.1097 / PAS.0b013e31817f9790. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Kong CS, Narasimhan B, Cao H, Kwok S, Erickson JP, Koong A, et al.Связь между статусом вируса папилломы человека и другими молекулярными прогностическими маркерами плоскоклеточного рака головы и шеи. Int J Radiat Oncol Biol Phys. 2009. 74: 553–61. DOI: 10.1016 / j.ijrobp.2009.02.015. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Fakhry C, Westra WH, Li S, Cmelak A, Ridge JA, Pinto H и др. Повышение выживаемости пациентов с плоскоклеточным раком головы и шеи с положительным результатом на папилломавирус человека в проспективном клиническом исследовании. J Natl Cancer Inst. 2008; 100: 261–9.DOI: 10.1093 / jnci / djn011. [PubMed] [CrossRef] [Google Scholar] 48. Энг К.К., Харрис Дж., Уилер Р., Вебер Р., Розенталь Д.И., Нгуен-Тан П.Ф. и др. Вирус папилломы человека и выживаемость больных раком ротоглотки. N Engl J Med. 2010; 363: 24–35. DOI: 10.1056 / NEJMoa07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 49. Ришин Д., Янг Р.Дж., Фишер Р., Фокс С.Б., Ле QT, Петерс Л.Дж. и др. Прогностическое значение p16 INK4A и вируса папилломы человека у пациентов с раком ротоглотки, получавших TROG 02.02 испытание фазы III. J Clin Oncol. 2010. 28: 4142–8. DOI: 10.1200 / JCO.2010.29.2904. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Чакраварти А., ДеСильвио М., Чжан М., Гриньон Д., Розенталь С., Асбелл С. О. и др. Группа онкологической лучевой терапии. Прогностическое значение p16 при местнораспространенном раке простаты: исследование, основанное на протоколе 9202 группы онкологической лучевой терапии. J Clin Oncol. 2007. 25: 3082–9. DOI: 10.1200 / JCO.2006.08.4152. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 53. Саймон Г.Р., Турриси А.Ведение мелкоклеточного рака легкого: руководящие принципы клинической практики ACCP (2-е издание). Сундук 2007; 132: 324-39; PMID: 17873178; DOI: 10.1378 / Chess.07-1385 [PubMed] [CrossRef] [Google Scholar] 54. Herschkowitz JI, He X, Fan C, Perou CM. Функциональная потеря опухолевого супрессора ретинобластомы является обычным явлением при базальных и просветных карциномах молочной железы B. Рак молочной железы Res. 2008; 10: R75. DOI: 10.1186 / bcr2142. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Ли CT, Capodieci P, Osman I, Fazzari M, Ferrara J, Scher HI и др.Сверхэкспрессия ингибитора циклин-зависимой киназы p16 связана с рецидивом опухоли при раке простаты человека. Clin Cancer Res. 1999; 5: 977–83. [PubMed] [Google Scholar] 56. Bosco EE, Wang Y, Xu H, Zilfou JT, Knudsen KE, Aronow BJ, et al. Супрессор опухоли ретинобластомы изменяет терапевтический ответ рака груди. J Clin Invest. 2007. 117: 218–28. DOI: 10,1172 / JCI28803. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 57. Шарма А., Йео В.С., Эртель А., Коулман И., Клегг Н., Тангавел С. и др.Супрессор опухоли ретинобластомы контролирует передачу сигналов андрогенов и прогрессирование рака предстательной железы человека. J Clin Invest. 2010; 120: 4478–92. DOI: 10.1172 / JCI44239. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 58. D’Abaco GM, Hooper S, Paterson H, Marshall CJ. Потеря Rb отменяет потребность в активности ERK для пролиферации клеток. J Cell Sci. 2002; 115: 4607–16. DOI: 10.1242 / jcs.00161. [PubMed] [CrossRef] [Google Scholar] 59. Фрай Д.У., Харви П.Дж., Келлер П.Р., Эллиотт В.Л., Мид М., Трахет Э. и др.Специфическое ингибирование циклин-зависимой киназы 4/6 с помощью PD 0332991 и связанная с ним противоопухолевая активность в ксенотрансплантатах опухолей человека. Mol Cancer Ther. 2004; 3: 1427–38. [PubMed] [Google Scholar] 60. Дин Дж. Л., Тангавел С., МакКлендон А. К., Рид Калифорния, Кнудсен Э. С.. Терапевтическое ингибирование CDK4 / 6 при раке груди: ключевые механизмы ответа и отказа. Онкоген. 2010; 29: 4018–32. DOI: 10.1038 / onc.2010.154. [PubMed] [CrossRef] [Google Scholar] 61. Rivadeneira DB, Mayhew CN, Thangavel C, Sotillo E, Reed CA, Graña X и др.Подавление пролиферации посредством ингибирования CDK4 / 6: сложная функция пути ретинобластомы в ткани печени и клетках гепатомы. Гастроэнтерология. 2010; 138: 1920–30. DOI: 10.1053 / j.gastro.2010.01.007. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 62. Michaud K, Solomon DA, Oermann E, Kim JS, Zhong WZ, Prados MD, et al. Фармакологическое ингибирование циклин-зависимых киназ 4 и 6 останавливает рост мультиформных внутричерепных ксенотрансплантатов глиобластомы. Cancer Res. 2010; 70: 3228–38. DOI: 10.1158 / 0008-5472.CAN-09-4559. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

    Глобальные карты водно-болотных угодий из нескольких источников, сочетающие изображения поверхностных и подземных вод

    Adam, L., Döll, P., Prigent, C., и Papa, F .: Глобальный анализ спутниковые временные ряды естественно затопляемых территорий в качестве основы для моделирование поймы, Adv. Geosci., 27, 45–50, https://doi.org/10.5194/adgeo-27-45-2010, 2010.

    Aires, F., Miolane, L., Prigent, C., Pham, B., Fluet-Chouinard, E., Ленер, Б., и Папа, Ф .: Глобальный динамический набор данных о масштабах долгосрочного затопления в Высокое пространственное разрешение за счет уменьшения размера спутника Наблюдения, J. Hydrometeorol., 18, 1305–1325, https://doi.org/10.1175/JHM-D-16-0155.1, 2017.

    Bartholomé, E. and Belward, A.S .: GLC2000 ?: новый подход к глобальному картографирование земного покрова по данным наблюдения Земли, Int. J. Remote Sens., 26, 1959–1977, https://doi.org/10.1080/014311604123312

    , 2005.

    Бертье, Л., Барди, М., Чену, Дж., Гузмова, Л., Ларош, Б., Леманн, С., Lemercier, B., Martin, M., Mérot, P., Squividant, H., Thiry, E., and Вальтер, К.: Enveloppes des milieux Potentiellement Humides de la France métropolitaine — notice d’accompagnement, доступный по адресу: http://geowww.agrocampus-ouest.fr/metadata/pdf/Notice_MPH_France.pdf (последний доступ: январь 2019 г.), 2014 г.

    Бевен, К. Дж. и Киркби, М. Дж .: Физически обоснованная, изменяемая область накопления. модель гидрологии бассейна, Hydrol. Sci. Бюл., 24, 43–69, https: // doi.org / 10.1080 / 026266671834, 1979.

    Биркенс, М. Ф. П. и ван ден Херк, Б. Дж. Дж. М .: Конвергенция подземных вод как возможный механизм многолетней стойкости осадков, Geophys. Res. Lett., 34, 1–5, https://doi.org/10.1029/2006GL028396, 2007.

    Биллен, Дж. И Гарнье, Дж .: Перенос азота через дренаж Сены. сеть ?: бюджет, основанный на применении модели «Риверстрахлер», в: Man and River Systems, Springer, Нидерланды, 139–150, 1999.

    Collins, W.Дж., Беллуэн, Н., Дутрио-Буше, М., Гедни, Н., Халлоран, П., Хинтон, Т., Хьюз, Дж., Джонс, К. Д., Джоши, М., Лиддикоат, С., Мартин, Г., О’Коннор, Ф., Рэй, Дж., Сеньор, К., Ситч, С., Тоттерделл, И., Уилтшир, А., и Вудворд, С .: Разработка и оценка модели системы Земля — HadGEM2, Geosci. Модель Дев., 4, 1051–1075, https://doi.org/10.5194/gmd-4-1051-2011, 2011.

    Констанс, Э., Лаухлан, Х., Марк, В., Салай, Д., и Ференц, А .: Завод создание сообщества на восстановленном водно-болотном угодье?: Эффекты удаления почвы, Прил.Вег. Sci., 10, 383–390, 2007.

    Curie, F., Gaillard, S., Ducharne, A., and Bendjoudi, H .: Geomorphological методы характеристики водно-болотных угодий в масштабе водораздела Сены, Sci. Total Environ., 375, 59–68, https://doi.org/10.1016/j.scitotenv.2006.12.013, 2007.

    Curie, F., Ducharne, A., Bendjoudi, H., and Billen, G .: Пространство денитрификация в речных коридорах в водосборных бассейнах регионального масштаба?: тематическое исследование бассейна реки Сены // Phys. Chem. Земля, 36, 530–538, https: // doi.org / 10.1016 / j.pce.2009.02.004, 2011.

    de Graaf, I.E.M., Sutanudjaja, E.H., van Beek, L.P.H., и Bierkens, M. Ф. П .: Модель подземных вод в глобальном масштабе с высоким разрешением, Hydrol. Earth Syst. Sci., 19, 823–837, https://doi.org/10.5194/hess-19-823-2015, 2015.

    Дхоте С. и Диксит С .: Улучшение качества воды за счет макрофитов — a обзор, Environ. Монит. Оценка, 152, 149–153, https://doi.org/10.1007/s10661-008-0303-9, 2009.

    Дёлл, П. и Фидлер, К .: Моделирование пополнения подземных вод в глобальном масштабе. Hydrol.Earth Syst. Наук, 12, 863–885, https://doi.org/10.5194/hess-12-863-2008, 2008.

    Дюшарн, А .: Уменьшение масштабной зависимости в TOPMODEL с помощью безразмерного топографический указатель, Hydrol. Earth Syst. Наук, 13, 2399–2412, https://doi.org/10.5194/hess-13-2399-2009, 2009.

    Дюшарн, А., Оттле, К., Майнян, Ф., Вуичард, Н., Гаттас, Дж., Ван, Ф., Пейлин, П., Полчер, П., Гимберто, М., Моугис, П., Тафаск, С., Тутчи, А., Верхоф, А., Мидзуачи, Х .: Гидравлический модуль ORCHIDEE: научная документация, Техническая записка онлайн, 47 стр., можно купить в: http://forge.ipsl.jussieu.fr/orchidee/raw-attachment/wiki/Documentation/UserGuide/eqs_hydrol.pdf (последний доступ: январь 2019 г.), 2017 г.

    Fan, Y. and Miguez-Macho, G .: Простая гидрологическая структура для моделирования водно-болотные угодья в моделях климата и земных систем, Клим. Динамика, 37, 253–278, https://doi.org/10.1007/s00382-010-0829-8, 2011.

    Fan, Y., Li, H., and Miguez-Macho, G .: Global Patterns of Ground Water Table Глубина, Наука, 339, 940–943, https://doi.org/10.1126/science.1229881, 2013.

    Fan, Y., Miguez-Macho, G., Jobbágy, E.G., Jackson, R.B., и Otero-Casal, C .: Гидрологическое регулирование глубины укоренения растений, P. Natl. Акад. Sci. USA, 114, 10572–10577, https://doi.org/10.1073/pnas.1712381114, 2017.

    Фенг, М., Секстон, Дж. О., Чаннан, С., и Тауншенд, Дж. Р .: Глобальный, набор данных о внутренних водоемах с высоким разрешением (30 м) за 2000 год: первые результаты алгоритм топографо-спектральной классификации, Int. J. Digit. Земля, 8947, 1–21, https://doi.org/10.1080 / 17538947.2015.1026420, 2015.

    Финлейсон, К. М., Дэвидсон, Н. К., Спайерс, А. Г. и Стивенсон, Н. Дж .: Глобальная инвентаризация водно-болотных угодий — текущее состояние и будущие приоритеты, март. Freshw. Res., 50, 717, https://doi.org/10.1071/MF99098, 1999.

    Fluet-Chouinard, E., Lehner, B., Rebelo, L.M., Papa, F., and Hamilton, S. К .: Разработка карты глобального затопления с высоким пространственным разрешением от топографическое масштабирование крупномасштабных данных дистанционного зондирования, Remote Sens. Environ., 158, 348–361, https: // doi.org / 10.1016 / j.rse.2014.10.015, 2015.

    Фридл, М.А., Сулла-Менаше, Д., Тан, Б., Шнайдер, А., Раманкутти, Н., Сибли, А., Хуанг, X .: Глобальный земной покров MODIS Collection 5: алгоритм уточнения и характеристики новых наборов данных, Remote Sens. Environ., 114, 168–182, https://doi.org/10.1016/j.rse.2009.08.016, 2010.

    Фриц, С. и Си, Л.: Сравнение карт земного покрова с использованием нечеткого согласования. Int. J. Geogr. Инф. Sci., 19, 787–807, https://doi.org/10.1080/13658810500072020, 2005.

    Гедни Н. и Кокс П. М .: Чувствительность модели глобального климата Моделирование для представления неоднородности почвенной влаги, J. Гидрометеорология, 4, 1265–1275, https://doi.org/10.1175/1525-7541(2003)004<1265:TSOGCM>2.0.CO;2, 2003.

    Глисон, Т., Смит, Л., Моосдорф, Н., Хартманн, Дж. ., Дюрр, Х. Х., Мэннинг, А. Х., Ван Бик, Л. П. Х. и Еллинек А. М .: Картирование проницаемости по поверхность Земли, Geophys. Res. Lett., 38, 1–6, https://doi.org/10.1029/2010GL045565, 2011 г.

    Глисон Т., Мосдорф Н., Хартманн Дж. И ван Бик Л. П. Х .: Взгляд на под поверхностью земли: Глобальные гидрогеологические карты (GLHYMPS) проницаемости и пористость, Geophys. Res. Lett., 41, 3891–3898, 2014.

    Grippa, M., Mognard, N., and Le Toan, T .: Сравнение межгодовых изменчивость параметров снега по данным SSM / I и расходу реки Обь, Remote Sens. Environ., 98, 35–44, https://doi.org/10.1016/j.rse.2005.06.001, 2005.

    Gruber, S .: Вывод и анализ оценки глобального зонирование вечной мерзлоты, Криосфера, 6, 221–233, https: // doi.org / 10.5194 / tc-6-221-2012, 2012.

    Gumbricht, T., Roman-Cuesta, R.M., Verchot, L., Herold, M., Wittmann, F., Хаусхолдер, Э., Херольд, Н., Мурдиярсо, Д .: Модель экспертной системы для картирование тропических водно-болотных угодий и торфяников показывает, что Южная Америка является крупнейшим автор, Glob. Change Biol., 23, 3581–3599, https://doi.org/10.1111/gcb.13689, 2017.

    Гурц, Дж., Балтенсвайлер, А., Ланг, Х .: Пространственно распределенный гидротопное моделирование эвапотранспирации и стока в горных бассейны, Hydrol.Process., 13, 2751–2768, 1999.

    Гамильтон, Дж. Д., Келли, К. А., Радд, Дж. У. М., Хесслейн, Х. и Руле, Н. Т .: Поток в атмосферу CH 4 и CO 2 из водно-болотных угодий на Низины Гудзонова залива (HBLs), J. Geophys. Res., 99, 1495–1510, 1994.

    Harris, I., Jones, P. D., Osborn, T. J., and Lister, D.H .: Обновлено сетки ежемесячных климатических наблюдений высокого разрешения — CRU TS3.10 Набор данных, Int. J. Climatol., 34, 623–642, https://doi.org/10.1002/joc.3711, 2014.

    Hartmann, J. and Moosdorf, N .: Новая глобальная база данных литологических карт GLiM: Изображение свойств горных пород на поверхности Земли, Geochem. Geophys. Geosy., 13, 1–37, https://doi.org/10.1029/2012GC004370, 2012.

    Hattermann, F., Krysanova, V., Wechsung, F., and Wattenbach, M .: Integrating динамика подземных вод в региональном гидрологическом моделировании, Environ. Модель. Softw., 19, 1039–1051, https://doi.org/10.1016/j.envsoft.2003.11.007, 2004.

    Герольд, М., Ван Гренестейн, А., Коистра, Л., Калогиру, В., и Арино, О.: Land Cover CCI, Product User Guide Version 2.0, доступно по адресу: https://maps.elie.ucl.ac.be/CCI/viewer/download/ESACCI-LC-Ph3-PUGv2_2.0.pdf (последний доступ: январь 2019 г.), 2015 г.

    Hess, L. L., Melack, J. M., Affonso, A. G., Barbosa, C., Gastil-Buhl, M., and Ново, Э. М. Л. М .: Водно-болотные угодья низменного бассейна Амазонки: степень, растительность Покрытие и двухсезонная затопляемая зона согласно картированию синтетического материала JERS-1 Aperture Radar, Wetlands, 35, 745–756, https: // doi.org / 10.1007 / s13157-015-0666-y, 2015.

    Hesse, C., Krysanova, V., Päzolt, J., and Hattermann, F.F .: Эко-гидрологическое моделирование в строго регулируемом низинном водосборе для поиска меры по улучшению качества воды, Ecol. Модель., 218, 135–148, https://doi.org/10.1016/j.ecolmodel.2008.06.035, 2008.

    Ху, С., Ню, З., Чен, Ю., Ли, Л., и Чжан, Х .: Глобальные водно-болотные угодья : Потенциальный распространение, потеря водно-болотных угодий и статус, Sci. Total Environ., 586, 319–327, https://doi.org/10.1016/j.scitotenv.2017.02.001, 2017.

    InfoSol: Dictionnaire de données — DoneSol, версия 3.4, INRA, US 1106 InfoSol, Орлеан, Франция, 408 стр., 2013.

    Юнг, М., Хенкель, К., Герольд, М., и Чуркина, Г.: Использование синергии продукты глобального земного покрова для моделирования углеродного цикла, Remote Sens. Environ., 101, 534–553, https://doi.org/10.1016/j.rse.2006.01.020, 2006.

    Криннер, Г., Виови, Н., де Нобле-Дюкудре, Н., Оже, Дж. , Полчер, J., Friedlingstein, P., Ciais, P., Sitch, S., and Prentice, I.C .: динамический глобальная модель растительности для исследования взаимосвязанной атмосферы и биосферы система, Global Biogeochem. Cy., 19, 1–33, https://doi.org/10.1029/2003GB002199, 2005.

    Катчер, Т. Э .: Схема классификации местообитаний и земельного покрова для национальных Estuarine Research Reserve System, Национальный эстуарный исследовательский заповедник System (NERRS), 42 стр., 2008.

    Lafont, S., Zhao, Y., Calvet, J.-C., Peylin, P., Ciais, P., Maignan, F., and Вайс, М .: Моделирование LAI, поверхностных вод и потоков углерода с высоким разрешением. по Франции: сравнение ISBA-A-gs и ORCHIDEE, Biogeosciences, 9, 439–456, https: // doi.org / 10.5194 / bg-9-439-2012, 2012.

    Лэнг, М. У. и Маккарти, Г. У .: Интенсивность лидара для улучшенного обнаружения затопление под пологом леса, Болото, 29, 1166–1178, https://doi.org/10.1672/08-197.1, 2009.

    Ленер, Б. и Дёлл, П .: Разработка и проверка глобальной базы данных озер, водохранилищ и водно-болотных угодий, J. Hydrol., 296, 1–22, https://doi.org/10.1016/j.jhydrol.2004.03.028, 2004.

    Ленер Б., Вердин К. и Джарвис К.: Новая глобальная гидрография, основанная на данные о высоте из космоса, Eos T.Являюсь. Geophys. Un., 89, 93–94, 2008.

    Ли, Дж. И Чен, В .: Основанный на правилах метод картирования водно-болотных угодий Канады с использованием оптические, радиолокационные и ЦМР данные, Int. J. Remote Sens., 26, 5051–5069, https://doi.org/10.1080/01431160500166516, 2005.

    Линь, Ю. Х., Ло, М. Х. и Чжоу, К.: Возможные негативные эффекты динамика подземных вод на конвекцию засушливого сезона в бассейне реки Амазонки, Клим. Dynam., 46, 1001–1013, https://doi.org/10.1007/s00382-015-2628-8, 2016.

    Lo, M. H. and Famiglietti, J.С .: Реакция осадков на недра суши. гидрологические процессы в моделировании общей циркуляции атмосферы, J. Geophys. Res.-Atmos., 116, 1–18, https://doi.org/10.1029/2010JD015134, 2011.

    Манфреда С., Ди Лео М. и Соул А.: Обнаружение подверженных наводнениям Области использования Цифровые модели рельефа, J. ​​Hydrol. Eng., 16, 781–790, https://doi.org/10.1061/(ASCE)HE.1943-5584.0000367, 2011.

    Marthews, T. R., Dadson, S.J., Lehner, B., Abele, S., и Gedney, N .: Значения глобального топографического индекса с высоким разрешением для использования в крупномасштабных гидрологическое моделирование, Hydrol.Earth Syst. Наук, 19, с. 91–104, https://doi.org/10.5194/hess-19-91-2015, 2015.

    Matthews, E. and Fung, I .: Эмиссия метана из естественных водно-болотных угодий: Global распространение, площадь и экологические характеристики источников, Global Биогеохим. Cy., 1, 61–86, https://doi.org/10.1029/GB001i001p00061, 1987.

    Максвелл, Р. М., Коллет, С. Дж .: Взаимозависимость динамики грунтовых вод и обратная связь между сушей и энергией при изменении климата, Нац. Geosci., 1, 665–669, https://doi.org/10.1038/ngeo315, 2008 г.

    Максвелл, Р. М., Чоу, Ф. К., и Коллет, С. Дж .: The связь грунтовых вод, суши, поверхности и атмосферы: влияние влажности почвы на атмосферный пограничный слой в полностью связанном моделировании, Adv. Водный ресурс., 30, 2447–2466, https://doi.org/10.1016/j.advwatres.2007.05.018, 2007.

    Mérot, P., Squividant, H., Aurousseau, P., Hefting, M., Burt, Т., Мэтр, В., Крук, М., Буттурини, А., Тенейл, К., и Виуд, В.: Тестирование климато-топографический индекс для прогнозирования распространения водно-болотных угодий вдоль Европейский климатический градиент, Ecol.Модели., 163, 51–71, https://doi.org/10.1016/S0304-3800(02)00387-3, 2003.

    Messager, M. L., Lehner, B., Grill, G., Nedeva, I., and Schmitt, O .: Оценка объема и возраста воды, хранящейся в глобальных озерах, с использованием геостатистический подход, Нац. Commun., 7, 13603, https://doi.org/10.1038/ncomms13603, 2016.

    Миалон А., Ройер А. и Фили М .: Сезонная динамика водно-болотных угодий и межгодовая изменчивость над северными высокими широтами, полученная из микроволнового спутниковые данные, J. Geophys.Рес.-Атмос., 110, 11–19, https://doi.org/10.1029/2004JD005697, 2005.

    Миеттинен, Дж., Ши, К., и Лью, С. Юго-Восточная Азия с 2000 по 2010 гг., Glob. Change Biol., 17, 2261–2270, г. https://doi.org/10.1111/j.1365-2486.2011.02398.x, 2011.

    Мигес-Мачо, Г. и Фан, Й .: Роль грунтовых вод в воде Амазонки цикл ?: 1. Влияние на сезонный сток, наводнения и заболоченные земли, Дж. Geophys. Res., 117, 1–30, https://doi.org/10.1029/2012JD017539, 2012.

    Митч, У. Дж. И Госселинк, Дж. Г .: Wetlands, Jjohn Wiley & Sons Inc., New York, 2000.

    Mizuochi, H., Hiyama, T., Ohta, T., Fujioka, Y., Kambatuku, J. R., Iijima, М., Насахара К. Н .: Дистанционное зондирование окружающей среды, развитие и оценка подхода на основе таблицы поиска к объединению данных для сезонных Мониторинг водно-болотных угодий ?: Комплексное использование серии AMSR, MODIS и Landsat, Remote Sens. Environ., 199, 370–388, https://doi.org/10.1016/j.rse.2017.07.026, 2017.

    Mohamed, Y.и Савениже, Х. Х. Г .: Влияние изменчивости климата на гидрология водно-болотных угодий Садд: долгосрочные сигналы (1900–2000 гг.) расчеты водного баланса, Wetl. Ecol. Manag., 22, 191–198, https://doi.org/10.1007/s11273-014-9337-7, 2014.

    Mohamed, Y. A., Bastiaanssen, W. G. M., and Savenije, H.HG .: Spatial изменчивость испарения и накопления влаги в болотах верхнего Нил изучен методами дистанционного зондирования, J. Hydrol., 289, 145–164, https://doi.org/10.1016/j.jhydrol.2003.11.038, 2004.

    Накэгава, Т .: Сравнение связанных с водой типов почвенного покрова в шести 1 км. Глобальные наборы данных о земном покрове, J. Hydrometeorol., 13, 649–664, https://doi.org/10.1175/JHM-D-10-05036.1, 2012.

    Национальный исследовательский совет: Водно-болотные угодья: характеристики и границы, национальный Academies Press, Вашингтон, округ Колумбия, 1995.

    Озесми, С. Л. и Бауэр, М. Э .: Спутниковое дистанционное зондирование водно-болотных угодий, Wetl. Ecol. Manag., 10, 381–402, DOI: 101023 / A: 10202489, 2002.

    Пакален, М.С., Финкельштейн, С.А., и Маклафлин, Дж. В .: Хранение углерода и потенциальное производство метана в низменности Гудзонова залива с среднеголоценовое торфяное залегание, Nat. Commun., 5, 4078, https://doi.org/10.1038/ncomms5078, 2014.

    Papa, F., Prigent, C., Aires, F., Jimenez, C., Rossow, W. B., and Matthews, E .: Межгодовая изменчивость площади поверхностных вод в глобальном масштабе. 1993–2004, J. Geophys. Res.-Atmos., 115, 1–17, https://doi.org/10.1029/2009JD012674, 2010 г.

    Парренс, М., Аль-Битар, А., Фраппар, Ф., Папа, Ф., Калмант, С., Крето, Ж.-Ф., Вигнерон Ж.-П. и Керр Ю.: Отображение динамической доли воды при тропические дождевые леса бассейна Амазонки от SMOS Brightness Температура, вода, 9, 350, https://doi.org/10.3390/w50, 2017.

    Пасси, П., Гарнье, Дж., Биллен, Г., Фесно, К., и Турнебиз, Дж .: Наука Комплексного экологического восстановления водоемов в сельских ландшафтах ?: Моделирование влияние на нитратное загрязнение поверхностных вод (бассейн реки Сены, Франция), Sci.Total Environ., 430, 280–290, https://doi.org/10.1016/j.scitotenv.2012.04.035, 2012.

    Pekel, J.-F., Cottam, A., Gorelick, N., and Belward, A.S .: Высокое разрешение картографирование глобальных поверхностных вод и их долгосрочных изменений, Nature, 1–19, https://doi.org/10.1038/nature20584, 2016.

    Перес-Ойос, А., Гарсия-Аро, Ф. Дж., и Сан-Мигель-Аянц, Дж .: А методология создания синергетической карты земного покрова путем объединения различных продукты растительного покрова, Int. J. Appl. Earth Obs. Геоинф., 19, 72–87, https: // doi.org / 10.1016 / j.jag.2012.04.011, 2012.

    Писон, И., Берше, А., Сонуа, М., Буске, П., Броке, Г., Кониль, С., Дельмотт, М., Ганесан, А., Лоран, О., Мартин, Д., О’Догерти, С., Рамонет, М., Испания, Т. Г., Вермёлен, А., Ивер Квок, К.: Как европейская сеть может помочь с оценкой выбросов метана по французской национальной шкале, Атмос. Chem. Phys., 18, 3779–3798, https://doi.org/10.5194/acp-18-3779-2018, 2018.

    Post, J., Conradt, T., Suckow, F., Krysanova, V., Wechsung, F., а также Хаттерманн, Ф. Ф .: Комплексная оценка чувствительности пахотных земель к углероду. к недавнему и будущему климату в бассейне реки Эльба, Hydrol. Sci. J., 53, 1043–1058, https://doi.org/10.1623/hysj.53.5.1043, 2008.

    Поултер, Б., Буске, П., Канадель, Дж. Г., Киаис, П., Перегон, А., Сонуа, М., Арора, В. К., Бирлинг, Д. Дж., Бровкин, В., Джонс, К., Джус, Ф., Гедни, Н., Ито, А., Келинен, Т., Ковен, К., Макдональд, К., Мелтон, Дж., Пэн, К., Пэн, С., Приджент, К., Шредер, Р., Рилет, В., Сайто, М., Спани, Р., Тиан, Х., Тейлор, Л., Виови, Н., Уилтон, Д., Уилтшир, А., Сюй, X., Чжан, Б., Чжан, З., Чжу, К .: Глобальный вклад водно-болотных угодий в атмосферный динамика темпов роста метана, Environ. Res. Lett., 12, 094013, https://doi.org/10.1088/1748-9326/aa8391, 2017.

    Приджент, К., Папа, Ф., Айрес, Ф., Россоу, В. Б., и Мэтьюз, Э .: Global динамика затопления по данным многочисленных спутниковых наблюдений, 1993–2000, J. Geophys. Res.-Atmos., 112, D12107, https: // doi.org / 10.1029 / 2006JD007847, 2007.

    Qiu, C., Zhu, D., Ciais, P., Guenet, B., Peng, S., Krinner, G., Tootchi, A., Дюшарн А. и Хасти А. Моделирование площади северных торфяников и углерода. динамика с голоцена с помощью модели земной поверхности ORCHIDEE-PEAT (SVN r5488), Geosci. Модель Dev. Обсудить., Https://doi.org/10.5194/gmd-2018-256, в обзор, 2018.

    Рамсарская конвенция: стратегические рамки и руководящие принципы будущего развития Список водно-болотных угодий международного значения Конвенции о водно-болотных угодьях (Рамсар, Иран, 1971 г.), Strateg.Framew. Список, 11, 91 с., http://archive.ramsar.org/pdf/guide/guide-list2009-e.pdf (последний доступ: Январь 2019), 2009.

    Раймонд, П. А., Хартманн, Дж., Лауэрвальд, Р., Собек, С., Макдональд, К., Гувер, М., Бутман, Д., Стригль, Р., Майорга, Э., Хумборг, К., Кортелайнен, П., Дюрр, Х., Мейбек, М., Сиаис, П., и Гут, П.: Глобальный диоксид углерода выбросы из внутренних вод, Nature, 503, 355–359, https://doi.org/10.1038/nature12760, 2013.

    Репо, М., Хуттунен, Дж. Т., Наумов, А.В., Чичулин А.В., Лапшина Е.Д., Блейтен В. и Мартикайнен П. Дж .: выброс CO 2 и CH 4 из малых заболоченные озера, Теллус, 59, 788–796, https://doi.org/10.1111/j.1600-0889.2007.00301.x, 2007.

    Ричи, Дж. Э., Мелак, Дж. М., Ауфденкампе, А. К., Баллестер, В. М., и Хесс, Л.Л .: Выделение газов из рек и водно-болотных угодий Амазонки как большой тропический источник атмосферного CO 2 , Nature, 416, 617–620, 2002.

    Ringeval, B., Friedlingstein, P., Ковен, C., Ciais, P., de Нобле-Дюкудре, Н., Дечарм, Б., и Кадул, П .: Climate – CH 4 обратная связь с водно-болотными угодьями и ее взаимодействие с климатом-CO 2 обратная связь, Biogeosciences, 8, 2137–2157, https://doi.org/10.5194/bg-8-2137-2011, 2011.

    Ringeval, B., Decharme, B., Piao, SL, Ciais, P., Papa , F., de Нобле-Дюкудре, Н., Приджент, К., Фридлингштейн, П., Гуттевин, И., Ковен, К., Дюшарн, А.: Моделирование подсеточных водно-болотных угодий в ORCHIDEE глобальная модель земной поверхности: оценка по речным стокам и дистанционно считываемые данные, Geosci.Модель Дев., 5, 941–962, https://doi.org/10.5194/gmd-5-941-2012, 2012.

    Rodhe, A. и Seibert, J .: Наличие водно-болотных угодий в зависимости от топографии: A тест топографических показателей как индикаторов влажности, Agr. Лесная метеорология, 98–99, 325–340, https://doi.org/10.1016/S0168-1923(99)00104-5, 1999.

    Солнье, Г., Бевен, К., и Облед, Ч .: Включая пространственно переменные эффективная глубина почвы в TOPMODEL, J. Hydrol., 202, 158–172, 1997.

    Saunois, M., Bousquet, P., Poulter, B., Перегон, А., Кайс, П., Канаделл, Дж. G., Dlugokencky, E.J., Etiope, G., Bastviken, D., Houweling, S., Янссенс-Маенхаут, Г., Тубьелло, Ф. Н., Кастальди, С., Джексон, Р. Б., Алексей, М., Арора, В. К., Бирлинг, Д. Дж., Бергамаски, П., Блейк, Д. Р., Брейлсфорд, Г., Бровкин, В., Брювилер, Л., Кревуазье, К., Криль, П., Кови, К., Карри, К., Франкенберг, К., Гедни, Н., Хёглунд-Исакссон, Л., Исидзава, М., Ито, A., Joos, F., Kim, H.-S., Kleinen, T., Krummel, P., Lamarque, J.-F., Лангенфельдс Р., Локателли Р., Мачида, Т., Максютов, С., Макдональд, К.С., Маршалл, Дж., Мелтон, Дж. Р., Морино, И., Найк, В., О’Догерти, С., Парментье, F.-J. В., Патра, П. К., Пэн, К., Пэн, С., Петерс, Г. П., Писон, И., Приджент, К., Принн, Р., Рамонет, М., Райли, В. Дж., Сайто, М., Сантини, М., Шредер Р., Симпсон И. Дж., Спани Р., Стил П., Такидзава А., Торнтон, Б.Ф., Тиан, Х., Тодзима, Ю., Виови, Н., Вулгаракис, А., ван Weele, M., van der Werf, G.R., Weiss, R., Wiedinmyer, C., Wilton, D.J., Уилтшир, А., Уорти, Д., Вунч, Д., Сюй, X., Ёсида, Ю., Чжан, Б., Чжан, З. и Чжу Q .: Глобальный бюджет метана в 2000–2012 гг., Earth Syst. Sci. Данные, 8, 697–751, https://doi.org/10.5194/essd-8-697-2016, 2016.

    Щепащенко Д., МакКаллум И., Швиденко А., Фриц С., Кракснер, F., и Оберштайнер, М .: Новый гибридный набор данных о земном покрове для России: методология. за интеграцию статистики, дистанционного зондирования и информации на местах, J. Land Use Sci., 6, 245–259, https://doi.org/10.1080/1747423X.2010.511681, 2011.

    Шнайдер, А.С., Йост, А., Кулон, К., Сильвестр, М., Тери, С., и Дюшарн, А .: Извлечение речной сети в глобальном масштабе на основе высокого разрешения. топография, ограниченная литологией, климатом, уклоном и наблюдаемым стоком плотность, геофиз. Res. Lett., 44, 2773–2781, https://doi.org/10.1002/2016GL071844, 2017.

    Шредер, Р., Макдональд, К. К., Чепмен, Б. Д., Дженсен, К., Подест, Э., Тесслер, З. Д., Бон, Т. Дж., И Циммерманн, Р.: Разработка и оценка многолетнего набора фракционных данных о поверхностных водах, полученных из активных / пассивных данные микроволнового дистанционного зондирования, Remote Sens., 7, 16688–16732, https://doi.org/10.3390/rs71215843, 2015.

    Соренсен Р., Зинко У. и Зайберт Дж .: О расчете топографический индекс влажности: оценка различных методов в зависимости от поля наблюдения, Hydrol. Earth Syst. Наук, 10, с. 101–112, https://doi.org/10.5194/hess-10-101-2006, 2006.

    Стерлинг, С. и Дюшарн, А .: Полный набор данных о глобальном земном покрове. изменение для приложений модели земной поверхности, Global Biogeochem. Cy., 22, г. GB3017, https://doi.org/10.1029 / 2007gb002959, 2008.

    Стерлинг, С. М., Дюшарн, А., Полчер, Дж .: Влияние глобального изменение почвенного покрова в круговороте воды на суше, Нац. Клим. Изменить, 3, 385–390, https://doi.org/10.1038/nclimate1690, 2013.

    Stibig, H.-J., Achard, F., Carboni, S., Raši, R., and Miettinen, J .: Изменение площади тропических лесов Юго-Восточной Азии с 1990 по 2010 гг., Biogeosciences, 11, 247–258, https://doi.org/10.5194/bg-11-247-2014, 2014.

    Сатклифф, Дж., Херст, С., Авадаллах, А.Г. и Браун, Э .: Гарольд Эдвин Херст ?: Нил и Египет, прошлое и будущее, Hydrol. Sci. J., 61, 1557–1570, https://doi.org/10.1080/02626667.2015.1019508, 2016.

    Тамеа С., Мунипиракул Р., Лайо Ф., Ридольфи Л. и Родригес-Итурбе, И .: Стохастическое описание колебаний уровня грунтовых вод на водно-болотных угодьях, Geophys. Res. Lett., 37, 1–5, https://doi.org/10.1029/2009GL041633, 2010.

    Тутчи, А., Йост, А., и Дюшарн, А.: Глобальные карты водно-болотных угодий из разных источников. объединение изображений поверхностных вод и ограничений грунтовых вод, https: // doi.org / 10.1594 / PANGAEA.8

    , 2018.

    Туанму, М. Н. и Джетц, В.: Глобальный консенсусный продукт для моделирование биоразнообразия и экосистем, Glob. Ecol. Биогеогр., 23, 1031–1045, https://doi.org/10.1111/geb.12182, 2014.

    Инженерный корпус армии США: Руководство по разграничению водно-болотных угодий инженерного корпуса, 1987.

    US Geological Survey: Hydro1k Elevation Derivative Database, USGS, доступно. на: https://lta.cr.usgs.gov/HYDRO1K (последний доступ: январь 2019 г.), 2000.

    Vergnes, J., Дечарм Б. и Хабетс Ф .: Введение грунтовых вод. капиллярные подъемы с использованием подсеточной пространственной изменчивости топографии в ISBA модель земной поверхности, J. Geophys. Res.-Atmos., 119, 11065–11086, г. https://doi.org/10.1002/2014JD021573, 2014.

    Verpoorter, C., Kutser, T., Seekell, D.A., и Tranvik, L.J .: глобальный инвентаризация озер по спутниковым снимкам высокого разрешения, Geophys. Res. Lett., 41, 6396–6402, https://doi.org/10.1002/2014GL060641, 2014.

    Vidal, J. P., Мартин, Э., Франшистеги, Л., Байон, М., и Субейру, Ж. М .: 50-летний атмосферный реанализ высокого разрешения над Францией с Safran system, Int. J. Climatol., 30, 1627–1644, https://doi.org/10.1002/joc.2003, 2010.

    Walvoord, M. A. и Kurylyk, B.L .: Гидрологические воздействия таяния вечной мерзлоты — Обзор, Vadose Zone J., 15, https://doi.org/10.2136/vzj2016.01.0010, 2016.

    Wang, F., Ducharne, A., Cheruy, F., Lo, MH, and Grandpeix , JY: Воздействие поверхностного слоя подземных вод на глобальный круговорот воды в IPSL сопряженная модель земля – атмосфера, Clim.Dynam., 50, 3505–3522, г. https://doi.org/10.1007/s00382-017-3820-9, 2018.

    Ваня, Р., Мелтон, Дж. Р., Ходсон, Э. Л., Поултер, Б., Рингеваль, Б., Спани, Р., Бон, Т., Авис, К. А., Чен, Г., Елисеев, А. В., Хопкрофт, П. О., Райли, В. Дж., Субин, З. М., Тиан, Х., ван Бодегом, П. М., Кляйнен, Т., Ю, З. К., Сингарайер, Дж. С., Цюрчер, С., Леттенмайер, Д. П., Бирлинг, Д. Дж., Денисов, С. Н., Приджент, К., Папа, Ф., и Каплан, Дж. О .: Современное состояние глобальная протяженность водно-болотных угодий и моделирование метана водно-болотных угодий: методология модели проект взаимного сравнения (WETCHIMP), Geosci.Модель Дев., 6, 617–641, https://doi.org/10.5194/gmd-6-617-2013, 2013.

    Wulder, M. A., White, J. C., Loveland, T. R., Woodcock, C. E., Belward, A. С., Коэн, В. Б., Фоснайт, Э. А., Шоу, Дж., Масек, Дж. Г., и Рой, Д. П.: Глобальный архив Landsat: статус, консолидация и направление, удаленный Sens. Environ., 185, 271–283, https://doi.org/10.1016/j.rse.2015.11.032, 2016.

    Волок Д. М. и МакКейб Дж. Дж .: сравнение одиночного и множественного потока Алгоритм направления для расчета топографических параметров в TOPMODEL, Water Ресурс.Res., 31, 1315–1324, 1995.

    Yamazaki, D., Trigg, M. A., and Ikeshima, D .: Разработка глобальной карты водного объекта ∼90 м с использованием разновременных изображений Landsat, Remote Sens. Environ., 171, 337–351, https://doi.org/10.1016/j.rse.2015.10.014, 2015.

    Ямадзаки, Д., Икешима, Д., Таватари, Р., Ямагути, Т. , О’Лафлин, Ф., Нил, Дж. К., Сэмпсон, К. К., Канаэ, С., и Бейтс, П. Д.: карта высокой точности. высот глобальных ландшафтов, Geophys. Res. Lett., 44, 5844–5853, https://doi.org/10.1002 / 2017GL072874, 2017.

    Zhao, F., Veldkamp, ​​T. I. E., Frieler, K., Schewe, J., Ostberg, S., Willner, С., Шаубергер, Б., Гослинг, С. Н., Шмид, Х. М., Портманн, Ф. Т., Ленг, Г., Хуанг, М., Лю, X., Тан, К., Ханасаки, Н., Биманс, Х., Гертен, Д., Сато, Ю., Покхрел, Ю., Стак, Т., Кайс, П., Чанг, Дж., Дюшарн, А., Гимберто, М., Вада, Й., Ким, Х. и Ямадзаки, Д.: Критическая роль схема маршрутизации при моделировании пикового расхода реки в глобальных гидрологических условиях. модели, Environ.Res. Let., 12, 075003, https://doi.org/10.1088/1748-9326/aa725, 2017.

    Золтай, С. К. и Витт, Д. Х .: Водно-болотные угодья Канады: градиенты окружающей среды и классификации, Vegetatio, 118, 131–137, https://doi.org/10.1007/BF00045195, 1995.

    Doing Business Economy Profile 2015: Венесуэла, РБ

    Реферат
    Этот профиль экономики для Doing Business В 2015 году представлены 11 показателей «Ведение бизнеса» для Венесуэлы. РБ. Для удобства сравнения профиль также предоставляет данные для других выбранных экономик (компаратор экономики) по каждому показателю.«Ведение бизнеса 2015» — это 12-е издание из серии годовых отчетов, измеряющих нормативные акты, улучшающие деловую активность, и те, которые сдерживать это. Экономики ранжируются по простоте выполнения бизнес; на 2015 год РБ Венесуэлы занимает 182 место. рейтинг ведения бизнеса означает, что нормативно-правовая среда более благоприятен для запуска и работы местного фирма. «Ведение бизнеса» представляет количественные показатели по правила ведения бизнеса и защита прав собственности это можно сравнить по 189 экономикам Афганистана в Зимбабве и со временем.Меры ведения бизнеса нормативные акты, затрагивающие 11 сфер жизнедеятельности бизнеса известные как индикаторы. Десять из этих областей включены в этот годовой рейтинг по легкости ведения бизнеса: начало бизнес, получение разрешений на строительство, получение электричество, регистрация собственности, получение кредита, защита миноритарных инвесторов, уплата налогов, торговля границы, обеспечение исполнения контрактов и урегулирование несостоятельности.«Ведение бизнеса» также измеряет регулирование рынка труда, которое не входит в рейтинг этого года. Данные в данный отчет актуален на 1 июня 2014 г. (за исключением показатели уплаты налогов, охватывающие период с января по декабрь 2013 г.).

    Цитата

    «Группа Всемирного банка. 2014. Ведение бизнеса: профиль экономики 2015: Венесуэла, РБ. Вашингтон. © Всемирный банк. https: // openknowledge.worldbank.org/handle/10986/20985 Лицензия: CC BY 3.0 IGO. »

    границ | Создание ретинобластомы (Rb) 1-индуцибельной доминантно-отрицательной (DN) мыши модели

    Введение

    Ретинобластома 1 является членом-основателем семейства карманных белков, которое также включает гены p107 / Rbl1 и p130 / Rbl2 (Cobrinik, 2005). Rb1 играет хорошо зарекомендовавшую себя роль в большом количестве тканей для регуляции пролиферации, дифференцировки и апоптоза клеток посредством взаимодействия с растущим числом молекул, включая семейство факторов транскрипции E2F, которые регулируют клеточный цикл (Кореняк и Брем. , 2005; Sun et al., 2006). Ассоциация не- или гипофосфорилированного «активного» RB1 с разными членами семейства E2F предотвращает вступление в S фазу клеточного цикла (Korenjak and Brehm, 2005; Sun et al., 2006). Во время фазы G1 нормального клеточного цикла RB1 прогрессивно фосфорилируется комплексом, образованным циклином D1 и членами циклин D-зависимых киназ (CDKs; Adams, 2001). Фосфорилированный RB1 становится «неактивным», высвобождая связанный с ним фактор транскрипции E2F, тем самым обеспечивая переход в S-фазу (Korenjak and Brehm, 2005; Sun et al., 2006). Более двух десятилетий известно, что инактивация пути Rb1 является общей чертой практически для всех опухолей человека (Sherr, 1996; Classon and Harlow, 2002; Sherr and McCormick, 2002). Такие примечательные открытия предполагают, что для клетки человека практически невозможно подвергнуться пролиферации без инактивации Rb1 (Sherr, 1996). Тем не менее, большинство механизмов, лежащих в основе активности Rb1 в покоящихся и пролиферирующих клетках, еще предстоит изучить.

    В соответствии с узловой ролью RB1 во многих путях, экспериментальные попытки условно удалить RB1 у трансгенных мышей привели к аномалиям в кроветворной и нервной системе (Lee et al., 1992), а также в костях (Thomas et al., 2001 ), почки (Zhu et al., 2009), зубы (Andreeva et al., 2012), кожа (Wang et al., 2014), пищеварительный тракт (Guo et al., 2009), улитка (Mantela et al. , 2005; Weber et al., 2008) и сетчатке (Knudson, 1971; Lohmann, Gallie, 2004), за которыми следует массовая гибель клеток и гибель эмбрионов в середине беременности (Lee et al., 1992; Wu et al., 2003). Хотя условная делеция Rb1 с помощью системы рекомбинации Cre-Lox помогает преодолеть проблемы с ранней эмбриональной летальностью, она по-прежнему приводит к массовой гибели клеток, как и ожидалось от постоянной делеции такого ключевого регулятора выживания и гомеостаза клеток (Chau and Wang, 2003 ; Mantela et al., 2005; Weber et al., 2008).

    В течение последнего десятилетия растет интерес к изучению потенциального терапевтического применения инактивации Rb1 для регенерации тканей (Bakay et al., 2006; Гудрич, 2006; Du and Searle, 2009; Кнудсен и Ван, 2010; Wang et al., 2013) и, в частности, регенерации HC (Mantela et al., 2005; Sage et al., 2005, 2006; Weber et al., 2008). Тем не менее, на сегодняшний день нет доступных моделей, которые позволили бы обратимую инактивацию Rb1 и связанных с ним факторов. Такие исследования могут быть значительно облегчены при использовании мышей, несущих условные нулевые аллели Rb1 . Мы сообщаем здесь о создании и характеристике мышиной модели TetO-DN-CB-myc6-Rb1 (DN-CBRb), которая сочетает в себе индуцибельную природу контролируемой тетрациклином системы активации транскрипции (TetO), лизосомальной слитой протеазы pre -прокатепсин B (CB) и часть кодирующей последовательности Rb1 для создания доминантно-отрицательного (DN) мутанта RB1.Как и любой другой белок, предназначенный для лизосомы, CB синтезируется рибосомами, связанными с эндоплазматическим ретикулумом (ER), посттрансляционно модифицируется в Golgi и в конечном итоге направляется в лизосомы (Kominami et al., 1991; Li et al., 1996). С другой стороны, RB1 физически взаимодействует и модулирует активность многих различных клеточных белков (Morris and Dyson, 2001; Goodrich, 2006). Следовательно, комбинация гибридной протеазы CB с геном Rb1 приводит к трансгену, который может оказывать DN-эффект на эндогенный белок RB1, а также на любой другой белок, который ассоциируется с RB1 (Li et al., 1996, 2000). Мутации DN легче всего описать в белках, которые функционируют как димеры или мультимеры. На сегодняшний день нет данных о гомодимеризации RB1. Тем не менее, неотъемлемая природа его активности допускает присутствие множества молекул, связанных с RB1 в любой момент времени (Goodrich, 2006). Всякий раз, когда комплекс, взаимодействующий с RB1, имеет более одного сайта связывания RB1, который занят белком DN-CBRb, он вызывает DN-ингибирование эндогенного белка RB1 и приводит к фенотипу с нулевым RB1.Более того, если хотя бы одна молекула RB1 в комплексе, взаимодействующем с RB1, является DN-CBRb, это будет препятствовать тому, чтобы весь комплекс выполнял свою нормальную роль, направляя его в лизосому для деградации.

    Мы описываем здесь создание трансгена DN RB1 и предоставляем доказательства его функциональности in vitro и in vivo . Селекция этой мыши с тканеспецифическими промоторами, управляющими линиями tTA или rtTA, в отсутствие или в присутствии доксициклина (Dox), соответственно, приведет к экспрессии слитого белка DN-CBRb, который может связываться с молекулами, взаимодействующими с RB1. , способствуя его лизосомной деградации.Первоначальная характеристика модели мышей DN-CBRb поддерживает ингибирование DN белка RB1 в ряде различных систем, в которых известна экспрессия Rb1 , включая внутреннее ухо. В соответствии с профилем экспрессии RB1 в постнатальном (P) органе Корти (OC; Mantela et al., 2005), избыточные внутренние HC (IHC) наблюдались по длине улитки на P10 и P28, особенно концентрированные в средней и базальные витки улитки. Внутреннее свойство гибридного белка CB, связанное с RB1-опосредованным белок-белковым взаимодействием и в сочетании с обратимой индуцибельностью системы TetO, делает эту модель на мышах интересной для оценки возможности временной и обратимой инактивации Rb1 для восстановления утраченных HCs.

    Материалы и методы

    Животные

    Трансгенный препарат DN-CBRb, разработанный в этом исследовании, является жизнеспособным и не обнаруживает аномалий развития. Геномную ДНК от мышей дикого типа и DN-CBRb-положительных (DN-CBRb + ) мышей подвергали стандартной ПЦР, как описано ниже. Продукты ПЦР обоих генотипов очищали и секвенировали с использованием генетического анализатора ABI Prism® 3100 для подтверждения сайта мутации. Линия мышей rtTA (B6.Cg-Gt (ROSA) 26Sortm1 (rtTA * M2) Jae / J: исходный номер Jaxmice 006965) была приобретена в Jackson Laboratories.Для экспериментов использовали дважды положительных мышей, несущих как трансген DN-CBRb, так и аллель индуктора rtTA (DN-CBRb + / ROSA-CAG-rtTA + ). Экспериментальные группы отрицательного контроля состояли из мышей, отрицательных по CBRb и положительных по rtTA (DN-CBRb / ROSA-CAG-rtTA + ), а также мышей, положительных по CBRb и отрицательных по rtTA (DN-CBRb + / ROSA-CAG-rtTA ). Создание трансгенной линии DN-CBRb и все эксперименты по уходу за животными, связанные с этим исследованием, были одобрены Комитетом по уходу и использованию животных Университета Крейтон (IACUC).

    Генерация

    CB-Myc 6 -Rb1 Трансгенная конструкция

    Чтобы проверить возможность использования слияния с лизосомальной протеазой в качестве эффективного средства, вызывающего DN-ингибирование RB1, мы амплифицировали фрагмент кДНК Rb1 длиной 1583 п.н., соответствующий аминокислотной области 369–896 белка RB1 (528 аминокислотных остатков). кислоты). Этот фрагмент был клонирован между сайтами рестрикции EcoR1 и XbaI вектора pCS2 + CB-Myc 6 (подарок от Dr.Маршал Хорвиц, Вашингтонский университет; Li et al., 1996, 2000), чтобы слить его с конструкцией CB-Myc 6 длиной 1012 пар оснований (337 аминокислот; рис. 1A). Продукт слияния привел к пептиду из 865 аминокислот с CB-Myc 6 на N-конце и Rb1 на C-конце. Продукт слияния имеет приблизительный размер 108 кДа, что немного меньше эндогенного белка RB1 (~ 110 кДа). Фрагмент слияния CB-Myc 6 -RB был амплифицирован с помощью ПЦР и клонирован в вектор сплайсинга pTet между сайтами рестрикции SalI и EcoRV для получения Tet (O) -DN-CBRB под тетрациклиновым промотором (рис. 1В). ).

    РИСУНОК 1. Получение конструкции CB-Myc6-Rb1 . (A) клонирование фрагмента Rb1 в вектор pCS2-CB-Myc6 . Продукт гена Rb1 размером 1583 п.н. амплифицировали с помощью ПЦР с использованием прямого и обратного праймеров. Полученный в результате фрагмент Rb1 клонировали между сайтами рестрикции EcoRI и Xbal вектора pCS2, содержащего конструкцию CB-Myc6 (фрагмент гена CB 1012bp и гексамерный тег последовательности Myc6 ), как описано ранее ( Ли и др., 1996, 2000). (B) Фрагмент CB-Myc6-Rb1 клонировали в вектор pTetSplice между сайтами рестрикции SalI и EcoRV .

    In vitro Тестирование трансгена DN-CBRb и создание трансгенной мыши

    Чтобы стимулировать сверхэкспрессию in vitro и проверить обратимость трансгена, очищенную плазмиду pTet-Splice, содержащую кассету DN-CBRb, котрансфицировали в клетки HEK293 как с DN-CBRb, так и с вектором трансактиватора pCMV-Tet3G, контролируемым тетрациклином. (Clonetech Laboratories, Inc.), в течение 24 ч. По истечении этого периода среду Dox удаляли, а часть клеток промывали от двух до трех раз PBS и инкубировали в среде без Dox в течение дополнительных 24 часов, чтобы обеспечить инактивацию трансгена. Контрольные образцы состояли из котрансфицированных клеток, не обработанных Dox, а также клеток HEK293, трансфицированных только трансактиваторным вектором pCMV-Tet3G и обработанных Dox в течение 24-часового периода. После подтверждения эффективной Dox-регуляции трансгена DN-CBRb всю кассету от промотора до конца элемента терминатора полиА SV40 вырезали из вектора, очищали в геле и использовали для создания трансгенных мышей-основателей.Мыши-основатели были созданы с использованием стандартных методик в лаборатории Mouse Genome Engineering Core в Медицинском центре Университета Небраски. Генотипирование детенышей проводили с использованием набора праймеров, специфичных для области слияния CB-Rb1 , состоящего из прямого праймера 5 ‘CTGTGGCATTGAATCAGAAATTGTGGCTGG 3’ и обратного праймера 5 ‘GTACTTCTGCTATATGTGGCCATTACAACC 3’ (рисунок 1B), амплифицированный продукт размером примерно 40 п.н. CB регион + 341 Rb1 регион; Рисунок 2). Было выявлено несколько независимых линий учредителей DN-CBRb.Пять из этих линий были подтверждены на передачу трансгена по зародышевой линии. Две из этих линий были дополнительно выведены для создания племенных колоний и для проверки экспрессии трансгена (т.е. линии 7 и 14). Однако представленные здесь результаты соответствуют данным, собранным только из строки 14. Репродуктивные проблемы с линией 7 не позволили нам полностью проанализировать эту линию.

    РИСУНОК 2. Генотипирование модели мыши DN-CBRb. ПЦР с праймерами, специфичными для гибридного трансгена CB-Rb1 , привела к полосе 401 п.н. у DN-CBRb-положительных животных (дорожки 2, 4 и 5), но не у животных, у которых трансген отсутствовал (дорожки 1 и 3). ).Генотип rtTA определяли в соответствии с протоколом, доступным на веб-сайте Jackson Laboratories (http://jaxmice.jax.org/strain/006965.html). (+) = Контрольная ДНК, показывающая трансген. (-) = Контрольная ПЦР, не содержащая ДНК. M = лестница ДНК 100 п.н.

    Трансфекция трансгена DN-CBRb в клетках HEI-OC1

    клеток HEI-OC1, любезно предоставленных доктором Федрико Калинеком (Школа медицины Дэвида Геффена, Калифорнийский университет в Лос-Анджелесе, Калифорния, США), поддерживали при 33 ° C с 10% CO2 (в допустимых условиях) с 10% DMEM ( № 11965-084, GIBCO-BRL).10000 клеток помещали на 96-луночный планшет и оставляли на ночь для инкубации. На следующий день осуществляли временную трансфекцию конструкции DN-CBRB и rtTA с использованием реагента для трансфекции на основе липидов DharmaFECT Duo (T-2010-03). Скорость трансфекции HEI-OC1 рассчитывали на основе pmR-ZsGreen1 (Clontech), где трансфицированные клетки проявляли зеленую флуоресценцию. 2 мкг pmR-ZsGreen1 трансфицировали параллельно в отдельной лунке. 1 мкг / мл Dox был предоставлен для экспериментальных образцов. Экспрессию плазмиды измеряли через 24 часа после трансфекции, и скорость трансфекции рассчитывали путем подсчета количества GFP-положительных клеток по отношению к общему количеству клеток, меченных Hoechst.Была оценена степень трансфекции ~ 70%. Следует отметить, что обработка нетрансфицированных клеток HEI-OC1 Dox не влияла на экспрессию белка RB1 или пролиферацию клеток. Клеточную пролиферацию оценивали с помощью набора CyQuant NF для пролиферации клеток (Invitrogen, C35007). Анализ пролиферации клеток проводили через 48 часов после трансфекции в соответствии с протоколом производителя. Вкратце, среду для культивирования клеток удаляли и в каждую лунку микропланшета добавляли 100 мкл 1Х раствора для связывания красителя. Микропланшет инкубировали дополнительно 1 ч при 37 ° C.Интенсивность флуоресценции для каждого образца измеряли с использованием флюоресцентного микропланшет-ридера (FLUOstar OPTIMA, BMG Labtech) с возбуждением при 485 нм и детектированием эмиссии при 530 нм. Для количественной оценки возможной гибели клеток после трансфекции клетки HEI-OC1 обрабатывали трипсином и подсчитывали. 0,1 × 10 6 клеток помещали на покровное стекло в 12-луночный планшет и инкубировали в течение ночи при 37 ° C. На следующий день клетки трансфицировали конструкциями DN-CBRb и rtTA с использованием реагента для трансфекции на липидной основе DharmaFECT Duo (T-2010-03).Положительные контрольные образцы состояли из нетрансфицированных клеток HEI-OC1, обработанных 1 мкМ стауроспорином в течение 4 часов. После 48 ч инкубации клетки HEI-OC1 анализировали на предмет обнаружения активных каспаз в соответствии с протоколом производителя (Millipore, APT523). Вкратце, добавляли 1X раствор реагента CaspaTag и клетки инкубировали при 37 ° C в течение 1 часа. 5 мкг / мл DAPI использовали для мечения ядер умирающих клеток в течение 10 мин при комнатной температуре. Клетки дважды промывали 1X промывочным буфером и фиксировали с использованием фиксатора, предоставленного поставщиком.После этого покровные стекла устанавливали и наблюдали под эпифлуоресцентным микроскопом (Nikon Eclipse 80i).

    In situ Гибридизация (ISH)

    Полный ISH, детектирующий мРНК DN-CBRb, проводили на обработанных Dox (экспериментальных) и необработанных (контроль) P21 DN-CBRb + / ROSA-CAG-rtTA + улиток мышей, как описано ранее (Barritt et al. др., 2012). Рибозонд длиной приблизительно 600 нуклеотидов был создан с помощью in vitro транскрипции продуктов ПЦР, полученных из кДНК DN-CBRb, с использованием праймера 5’GGCTGGCAGCCAACTCTTGGAACCTTGACTGG.Прореагировавшие ткани целиком помещали в глицерин для наблюдения под микроскопом или помещали в среду без рецепта перед замораживанием срезов на криостате микротома. Полное изображение и срезы были получены методом дифференциальной интерференционно-контрастной микроскопии на микроскопе Nikon Eclipse 80i. Срезы нейронов улитки и спирального ганглия контрастировали с помощью Nuclear Fast Red (Vector Laboratories, h4403).

    Экстракция РНК и количественный анализ Rt-PCR

    Суммарную РНК

    выделяли из рассеченных улиток с использованием набора RNeasy (Qiagen) в соответствии с инструкциями производителя.До 20 мкг общей РНК обрабатывали ДНКазой, не содержащей РНКаз (Turbo DNfree; Ambion), а концентрацию и качество РНК оценивали на спектрофотометре Nanodrop и Agilent Bioanalyzer соответственно. 250 нг РНК подвергали обратной транскрипции с использованием обратной транскриптазы MultiScribe и случайных праймеров (Applied Biosystems). Полуколичественный ПЦР-анализ проводили в трех экземплярах для каждого образца с использованием SYBR green (Applied Biosystems, StepOne plus system). Соответствующую амплификацию для каждого образца проводили с матрицей без фермента обратной транскриптазы и использовали в качестве контроля, чтобы исключить любое возможное геномное загрязнение.Амплификацию проводили с использованием набора праймеров, специфичных для области слияния CB-Rb1, состоящего из прямого праймера: 5 ‘CTGTGGCATTGAATCAGAAATTGTGGCTGG-3’ и обратного праймера 5’TACTTCTGCTATATGTGGCCATTACAACC-3 ‘, в течение 40 циклов. Относительное количественное определение содержания мРНК было нормализовано к эндогенному β-актину с использованием программного обеспечения StepOne (Applied Biosystems; версия 2.1). T -тесты проводили на нормализованных значениях экспрессии генов, чтобы определить, были ли различия статистически значимыми. P <0,05 считалось значимым.

    Регулирование трансгена DN-CBRb

    in vivo

    Для обеспечения экспрессии трансгена мышей DN-CBRb скрещивали с линией индукторов тетрациклина ROSA-CAG-rtTA . Генотипирование конструкции rtTA выполняли, как описано на веб-сайте Jackson Laboratories (http://jaxmice.jax.org/strain/006965.html). Двойные положительные (DN-CBRb + / ROSA-CAG-rtTA + ) и отрицательные контроли (DN-CBRb / ROSA-CAG-rtTA + , DN-CBRb + / ROSA-CAG-rtTA ) мышей лечили 2 мг / мл Dox в питьевой воде (после отъема) или через их кормящих матерей (до отъема).Были протестированы альтернативные дозы Докс (например, ниже или выше 2 мг / мл). Однако, поскольку метод зависит от объема воды, потребляемой животными, более низкие дозы оказались менее эффективными, что привело к высокой вариабельности фенотипа. Такая изменчивость объясняется уменьшением объема воды, потребляемой некоторыми животными, и, следовательно, меньшим поглощением Dox. Когда использовалось более 2 мг / мл, животные, как правило, пили меньше воды (и поглощали меньше Dox) из-за горького вкуса Dox.Дальнейшие эксперименты с инъекционным Dox в концентрациях выше 2 мг / мл не показали отличий от того, что мы обычно наблюдаем при добавлении 2 мг / мл Dox в питьевую воду. Следовательно, мы продолжили употребление Докса в питьевой воде. В конце лечения Dox были взяты несколько тканей (например, улитка, глаз, печень, сердце, легкие и почки) из DN-CBRb + / ROSA-CAG-rtTA + и DN- CBRb + / ROSA-CAG-rtTA контрольных мышей и хранились либо в стабилизирующем растворе RNAlater® (Ambion) для последующей экстракции РНК или белка, либо в 4% параформальдегиде (PFA) для гистологического анализа.

    Вестерн-блот

    Ткани, собранные в РНК позже и хранящиеся при -80 ° C, гомогенизировали в буфере для лизиса Ripa (Thermo Scientific № 89901) с ингибитором протеазы (Thermo Scientific № 88664). Гомогенизацию проводили с использованием гомогенизаторов Omni. Лизаты, полученные из тканей или клеток, центрифугировали при 14000 об / мин в течение 20 мин при 4 ° C. Супернатант использовали для оценки белка с использованием метода Лоури (набор для анализа белка BioRad DC № 500–0112). После этого 20 мкг белка разделяли на 10% SDS-PAGE, и белки затем переносили на PVDF-мембраны в приборе Bio-Rad TransBlot в соответствии с инструкциями производителя при 100 В в течение 90 мин.Белки переносили на мембрану из ПВДФ (Millipore Immobilon-P IPVh404FO) при 100 В в течение 90 мин с использованием аппарата с мокрым резервуаром Biorad. После инкубации в блокирующем растворе мембрану PVDF блокировали в 5% блокирующем растворе в течение 2 часов при комнатной температуре и зондировали в течение ночи при 4 ° C с помощью анти-RB1 (антитела против общего белка RB1; Abcam, ab6075), антиактивной каспазы 3. (Millipore, AB3623), анти-c-myc (Sigma, c3956) и анти-β-актин (Santa Cruz, sc-69879) в течение ночи при 4 ° C. Затем мембраны промывали и инкубировали с соответствующими вторичными антителами, конъюгированными с HRP, антикроличьими (Santa Cruz, sc-2054) и антимышиными (Santa Cruz, sc-358923) в течение 1 ч при комнатной температуре.После отмывки полосы связанного с пероксидазой белка визуализировали с помощью хемилюминесценции с использованием субстрата ECL (Pierce, Rockford, IL, USA).

    Гистологический анализ

    Полная иммуногистохимия была выполнена, как описано ранее (Rocha-Sanchez et al., 2011). Иммуногистологическое окрашивание миозина VIIa (M7a; Proteus Biosciences) и активной капсазы 3 (Millipore, AB3623) проводили на DN-CBRb + / ROSA-CAG-rtTA + и DN-CBRb / ROSA. -CAG-rtTA + фиксированные формалином цельные препараты рассеченного нейросенсорного эпителия улитки.Кусочки ткани (верхушка, середина и основание) блокировали / пермеабилизировали с помощью 5% NGS / 0,1% Tween 20 при комнатной температуре в течение 2–3 часов, инкубировали с первичным антителом в течение 48 часов в блокирующем буфере и трижды промывали PBS. . Затем образцы метили вторичными антителами, конъюгированными с Alexa 568 (1: 500; Invitrogen), промывали PBS, окрашивали DAPI (5 мкг / мл) в течение 2 часов при комнатной температуре. Затем улитки были закреплены с помощью Prolong anti-fade (Invitrogen) и визуализированы с помощью конфокального микроскопа Leica TCS SP8 MP.Подсчет клеток выполнялся на 200-кратных изображениях, полученных из трех разных областей (вершина, середина и основание) DN-CBRb + / ROSA-CAG-rtTA + и DN-CBRb / ROSA- CAG-rtTA + (контроль) улитки. Статистический анализ между двумя группами проводился с использованием парного теста t . Значения представлены как ± SEM. P <0,05 считалось значимым.

    Маркировка фаллоидином

    F-актин окрашивали фаллоидином, конъюгированным с Alexa 488.Вкратце, фиксированные формалином улитки трижды промывали PBS и повышали проницаемость с помощью 0,25% Triton X-100 в течение 10 мин. После этого ткань улитки метили Alexa 488-фаллоидином (1: 200; Sigma – Aldrich) в течение 30 мин. После трех промывок PBS образцы контрастировали с помощью DAPI и визуализировали с помощью конфокального микроскопа Leica TCS SP8 MP.

    Анализ пролиферации

    Для маркировки митотически активных клеток в DN-CBRb + / ROSA-CAG-rtTA вводили однократную подкожную инъекцию аналога тимидина 5-этинил-2′-дезоксиуридина (EdU; 50 мг / кг) в ДМСО. + и DN-CBRb + / ROSA-CAG-rtTA мышей за 4 часа до сбора тканей.Включение EdU в ДНК цельной улитки было обнаружено с помощью набора Click-iT EdU Alexa 488 Fluor Imaging (Invitrogen) и дважды окрашено DAPI в соответствии с инструкциями производителя и экспериментальными процедурами, описанными ранее (Kaiser et al., 2009; Rocha-Sanchez и др., 2011). Образцы получали с помощью конфокального микроскопа Leica TCS SP8 MP.

    Результаты

    Получение временно и условно индуцируемого трансгена DN-CBRb

    Чтобы преодолеть врожденные проблемы, связанные с полной и постоянной делецией Rb1 у мышей, мы стремились разработать DN-версию белка RB1, которая не только подавляла бы активность RB1, независимо от присутствия функционального эндогенного RB1, но также связывалась с ней. и запускают опосредованную протеасомами деградацию белковых комплексов, которые обычно связываются с RB1.С этой целью мы модифицировали ранее опубликованную систему (Li et al., 1996, 2000), состоящую из слияния протеазы препрокатепсина B, ассоциированной с большей частью всего домена кармана, и С-концевой области Rb1 . Полученная в результате кассета CB-myc6-RBf1ΔC (DN-CBRb) имеет делецию на конце карбоксила между остатками 369 и 896 (Li et al., 1996, 2000). Чтобы избежать осложнений, связанных с конститутивной элиминацией Rb1 , кассету DN-CBRb клонировали под промотором индуктора тетрациклина Tet (O), как описано в материалах и методах (Фигуры 1A, B). Тестирование конструкции in vitro проводили на клетках HEI-OC1, полученных из ОС, путем временной трансфекции. Экспрессию слитого белка детектировали вестерн-блоттингом с антителом против RB1, как описано ниже.

    In Vitro Оценка конструкции CB-Myc 6 -Rb1 Construct

    Для проверки эффективности Dox-регулируемой активации DN-CBRb и обратимости системы клетки HEK 293 котрансфицировали очищенной плазмидой pTet-Splice, содержащей конструкцию CB-Myc 6 -Rb1 и конструкцию pCMV- Вектор Tet3G.Добавление Dox в культуральную среду значительно подавляло экспрессию эндогенного белка RB1 (рис. 3). По истечении 24-часового периода обработка Dox прекращалась, и подмножество этих Dox-обработанных клеток HEK 293 получали среду, не содержащую Dox, на дополнительные 24 часа. В соответствии с обратимым характером системы, экспрессия RB1 восстанавливалась в этих клетках после удаления Dox из культуральной среды (рис. 3). Примечательно, что никаких изменений в экспрессии RB1 не наблюдалось на котрансфицированных клетках HEK 293, не обработанных Dox, или на обработанных Dox клетках HEK 293, трансфицированных только вектором pCMV-Tet3G (фиг. 3).

    РИСУНОК 3. Управляемая TetO, активируемая Dox экспрессия трансгена DN-CBRb приводит к подавлению регуляции эндогенного RB1 in vitro . Клетки HEK293, которые эндогенно экспрессируют RB1 (Chano et al., 2006), были котрансфицированы TetO-DN-CB-myc 6 -Rb1, и вектором-трансактиватором pCMV-Tet3G. В отсутствие Dox котрансфицированные клетки HEK293 стабильно экспрессировали RB1 (дорожка 1). Добавление Dox в систему на 24 часа привело к активации TetO-DN-CB-myc 6 -Rb1 и подавлению активности RB1 (дорожка 2).Культивирование подмножества этих клеток, обработанных Dox, в среде без Dox в течение дополнительных 24 ч позволило возобновить экспрессию RB1 (дорожка 3). C = контрольные клетки HEK293, трансфицированные только pCMV-Tet3G, обработанные Dox.

    Чтобы выяснить, приводит ли ингибирование экспрессии RB1 к увеличению пролиферации клеток, клетки HEI-OC1 котрансфицировали векторами pTet-Splice-DN-CBRb и pCMV-Tet3G и подвергали (контрольная группа) лечению Dox, поскольку описано выше. Увеличение пролиферации количественно оценивали путем измерения содержания ДНК как в экспериментальной, так и в контрольной группах, а также в нетрансфицированных клетках HEI-OC1.В соответствии с активацией конструкции DN-CBRb, результаты продемонстрировали, что котрансфекция векторами pTet-Splice-DN-CBRb и pCMV-Tet3G с последующей Dox-индуцированной экспрессией гена привела к умеренному, но значительному увеличению ДНК. содержания по сравнению с контрольными группами, что является косвенным показателем увеличения количества клеток (рис. 4). Напротив, не наблюдали значительных изменений в содержании ДНК между трансфицированными клетками HEI-OC1, не обработанными Dox, и нетрансфицированными клетками HEI-OC1 (рис. 4).Затем, чтобы оценить возможность гибели клеток после активации конструкции DN-CBRb, с помощью иммуноблоттинга измеряли уровни белка активной каспазы 3. Положительный контроль состоял из клеток HEI-OC1, обработанных 1 мкМ стауроспорина. В целом, не наблюдалось значительных изменений в уровнях активного белка каспазы 3 между нетрансфицированными контрольными (обработанными и необработанными Dox) и экспериментальными (трансфицированными / необработанными Dox и трансфецированными / обработанными Dox) клетками даже после 48 часов трансфекции (рис. 5A).Эти результаты были обобщены путем обнаружения in situ каспазы на нетрансфицированных контролях и экспериментальных клетках HEI-OC1 (Фигуры 5B, C). В отличие от этого, значительная гибель клеток наблюдалась на обработанных стауроспорином нетрансфицированных клетках HEI-OC1 (положительный контроль; фиг. 5D).

    РИСУНОК 4. Dox-опосредованная активация трансгена DN-CBRb увеличивает пролиферацию клеток. Клетки HEI-OC1, котрансфицированные очищенными векторами pTet-Splice-DN-CBRB и pCMV-Tet3G, культивировали в отсутствие (-) или в присутствии (+) Dox.Пролиферацию клеток определяли через 48 часов после трансфекции с использованием анализа пролиферации CYQUANT NF. Процентное изменение пролиферации рассчитывали с использованием изменения значений флуоресценции с нетрансфицированными клетками в качестве контроля. Умеренное, но значительное увеличение числа клеток наблюдалось на трансфицированных клетках после обработки Dox. Напротив, не наблюдали значительных изменений между трансфицированными клетками HEI-OC1, не обработанными (-Dox), и нетрансфицированным контролем. * P <0,05.

    РИСУНОК 5.Dox-опосредованная активация трансгена DN-CBRb не влияет на активную активацию каспазы 3. Клетки HEI-OCI, котрансфицированные с помощью TetO-DN-CB-myc6-Rb1 и вектора трансактиватора pCMV-Tet3G, культивировали в отсутствие (-) или в присутствии (+) Dox. (A) Экспрессия белка активной каспазы 3 в отсутствие или в присутствии Dox в течение 24 и 48 часов. (B – D) Иммуногистохимический анализ апоптотической гибели клеток с помощью анализа CaspaTag. (B) Нетрансфицированные клетки. (C) Трансфицированные клетки, обработанные Dox. (D) Нетрансфицированные клетки, обработанные стауроспорином (положительный контроль). Стрелки указывают на апоптотические клетки. S = нетрансфицированные клетки, обработанные стауроспорином в течение 4 часов; U = нетрансфицированные клетки; 1 = трансфицированные клетки, обработанные Dox только в течение 48 часов; 2 = трансфицированные клетки не обрабатывали Dox в течение 24 часов; 3 = трансфицированные клетки, обработанные Dox в течение 24 часов; 4 = трансфицированные клетки, не обработанные Dox в течение 48 часов; 5 = трансфицированные клетки, обработанные Dox в течение 48 часов. Бар = 10 мкм.

    In vivo Оценка активации конструкции CB-myc6-Rb1

    Для исследования функциональности конструкции CB-myc6-Rb1 in vivo вектор pTet-splice, содержащий кассету DN-CBRb, был расщеплен ферментом NotI для высвобождения трансгенной кассеты, включая промотор и терминатор. элементы.Очищенную в геле ДНК использовали для получения трансгенных мышей с использованием стандартных методик инъекции в пронуклеары. Трансгенные линии DN-CBRb далее скрещивали с линией индукторов тетрациклина ROSA-CAG-rtTA , которая обеспечивает повсеместную экспрессию DN-CBRb при введении Dox. Пометы от скрещивания DN-CBRb с ROSA-CAG-rtTA мышей генотипировали, как описано в материалах и методах. DN-CBRb + / ROSA-CAG-rtTA + и DN-CBRb / ROSA-CAG-rtTA + были индуцированы Dox и проанализированы на экспрессию трансгена.Были определены десять независимых линий учредителей DN-CBRb. Пять из этих линий были подтверждены на передачу трансгена по зародышевой линии и использовались в качестве основы для дальнейшего разведения. В настоящее время четыре из этих линий криоконсервированы. Представленные здесь результаты соответствуют одной линии мыши DN-CBRb. Чтобы изучить возможность применения метода in vivo , мы скрестили линию DN-CBRb с мышами с индуктором тетрациклина ROSA-CAG-rtTA . DN-CBRb + / Мыши ROSA-CAG-rtTA + не проявляли каких-либо дефицитов и их далее использовали для экспериментов по индукции трансгена.Кроме того, чтобы проверить любую потенциальную утечку экспрессии трансгена DN-CBRb, мы измерили экспрессию белка RB1 у мышей DN-CBRb + / ROSA-CAG-rtTA + в отсутствие или в присутствии Dox. Поддерживая жесткую регуляцию трансгена с помощью Dox, значительное снижение экспрессии белка RB1 наблюдалось у мышей DN-CBRb + / ROSA-CAG-rtTA + , получавших Dox, но не у необработанных DN-CBRb. + / ROSA-CAG-rtTA + мышей (Фиг.6).Принимая во внимание доказательства специфической Dox-регуляции DN-CBRb + / ROSA-CAG-rtTA + , в дополнение к тому факту, что не наблюдалось никакой утечки экспрессии трансгена ни в одной другой комбинации генотипов, ни в присутствии, ни в отсутствие Dox, мы решили использовать DN-CBRb / ROSA-CAG-rtTA + (вестерн-блоттинг и гистология) и DN-CBRb + / ROSA-CAG-rtTA (RT- ПЦР) в качестве отрицательного контроля.

    РИСУНОК 6.Dox-опосредованная активация DN-CBRb строго регулируется администрацией Dox. Cochleae of Dox, обработанные (дорожки 1–3) и необработанные (дорожки 4–6) P10 DN-CBRb + / ROSA-CAG-rtTA Мышей + подвергали Вестерн-блот-анализу с антителом против RB1. В соответствии с жесткой регуляцией экспрессии DN-CBRb путем введения Dox, не наблюдали эндогенной экспрессии RB1 на DN-CBRb + / ROSA-CAG-rtTA + улиток мышей в присутствии Dox.

    Чтобы определить время, необходимое для активации линии индуктора ROSA-CAG-rtTA и активации DN-CBRb, DN-CBRb + / ROSA-CAG-rtTA + мыши и DN-CBRb / ROSA-CAG-rtTA + мышей были разделены на три разные группы и вводили Dox с питьевой водой в течение 3 (Группа 1), 7 (Группа 2) и 10 (Группа 3) дней подряд. Сразу после обработки белок экстрагировали из улитки мышей на 36-й день постнатального (P) и анализировали с помощью вестерн-блоттинга с использованием мышиных гексамерных антител против RB1 и c-myc (Фигуры 7A – C).В соответствии с начальным накоплением белка RB1, количественная оценка кинетики дозы RB1-Dox выявила более чем 20-кратное увеличение белка RB1 в улитках дважды положительных мышей по сравнению с образцами отрицательного контроля (Фигуры 7A, D). Такое накопление может отражать обнаружение субъединиц DN-CBRb и нативного RB1 до их ассоциации и лизосомальной деградации. Это мнение было дополнительно подтверждено наблюдением, что DN-CBRb + / ROSA-CAG-rtTA + cochleae из групп 2 и 3 демонстрирует стабильно меньше белка RB, чем контрольные образцы (Рисунки 7B – D).Анализы биопсий печени и сердца подтвердили характер кинетики дозы RB1-Dox, описанный выше (данные не показаны). Следует отметить, что не наблюдали значительных различий в экспрессии RB1 у мышей, получавших Dox в течение периодов, превышающих 10 последовательных дней (данные не показаны). Следовательно, все обработки в последующих экспериментах проводились на 10-дневной терапии Dox.

    РИСУНОК 7. Активация трансгена DN-CBRb во внутреннем ухе постнатального (P) 36 DN-CBRb + / ROSA-CAG-rtTA + (CBRb + ) и DN-CBRb / ROSA-CAG-rtTA + (CBRb ) мышей после 3 (группа 1), 7 (группа 2) и 10 (группа 3) дней лечения Dox. (A – C) Anti-RB1, который реагирует как с гиперфосфорилированными, так и с гипофосфорилированными формами RB1, а также с антителами против c-myc. Денситометрический анализ был выполнен с использованием программного обеспечения ImageJ (http://imagej.nih.gov/ij/). Соответствующие полученные значения были нормализованы к отрицательному контролю CBRb (-), а затем к β-актину. Относительные уровни экспрессии RB1 показаны под каждым блотом. (D) Графическое представление нормализованных уровней экспрессии RB1 в зависимости от различных обработок подчеркивает стабильно более низкое обнаружение RB1 в образцах CBRb + .Каждая полоса на геле вестерн-блоттинга (A – C) и каждая колонка на графике (D) соответствуют разным индивидуумам и образцам. (-) = CBRb ; * P <0,05.

    Для исследования обратимости трансгена DN-CBRb in vivo , мышей P10 DN-CBRb + / ROSA-CAG-rtTA + кормили Dox с питьевой водой в течение 10 дней подряд. Контроль состоял из необработанных мышей DN-CBRb + / ROSA-CAG-rtTA + (Группа 1; -Dox).После этого периода животных умерщвляли либо сразу (Группа 2; + Dox), либо через 5 дней после отмены Dox (Группа 3; ± Dox). Улитки вскрывали и анализировали на экспрессию RB1 (рис. 8). По сравнению с контрольной необработанной группой, экспрессия RB1 была заметно снижена в группе 1 (фиг. 8). С другой стороны, подтверждая обратимость системы, экспрессия RB1 в группе 3 была увеличена по сравнению с группой 2. Эти результаты согласуются с ранее показанным анализом in vitro (рис. 3).

    РИСУНОК 8. Обратимая регуляция трансгена in vivo DN-CBRb. Мышей P10 DN-CBRb + / ROSA-CAG-rtTA + кормили Dox с питьевой водой в течение 10 дней подряд. Необработанные животные того же генотипа использовали в качестве контрольной группы (Группа 1; -Dox). По окончании лечения Dox животных умерщвляли либо сразу (Группа 2; + Dox), либо через 5 дней после отмены Dox (Группа 3; ± Dox). Поддерживая обратимость системы, уровни RB1 были заметно снижены во 2-й группе.Тем не менее, улитки, собранные через 5 дней после отмены Докса, показали уровни RB1, которые были сопоставимы с таковыми в контрольной группе.

    Чтобы оценить любые потенциальные тканеспецифические вариации эффективности Dox-опосредованной активации DN-CBRb, DN-CBRb + / ROSA-CAG-rtTA + и соответствующий возрасту DN-CBRb + / ROSA-CAG-rtTA мышей лечили Dox в течение 10 дней подряд. Биопсии улитки, легких, сердца и глаза были взяты из экспериментальной и контрольной групп на Р18 и подвергнуты вестерн-блоттингу с антителом против RB1 (фиг. 9A).Как и ожидалось, межтканевые вариации уровней экспрессии RB1 наблюдались в группе DN-CBRb + / ROSA-CAG-rtTA , при этом сетчатка и улитки показали более высокие концентрации RB1 (рис. 9A). В соответствии с представлением о возможном взаимодействии между RB1 дикого типа и трансгеном DN-CBRb, эндогенная экспрессия RB1 последовательно снижалась у всех мышей DN-CBRb + / ROSA-CAG-rtTA + . ткани проанализированы (рис. 8А).Несмотря на некоторые индивидуальные вариации остаточного количества белка RB1 после активации трансгена, экспрессия RB1 была заметно и значительно подавлена ​​по сравнению с контрольными животными (Фигуры 8A, B). Эти результаты согласуются с нашими количественными анализами ОТ-ПЦР в глазах, сердце и улитках для обработанных Dox DN-CBRb + / ROSA-CAG-rtTA + и сопоставимого по возрасту DN-CBRb , обработанного Dox. + / ROSA-CAG-rtTA мышей, которые показали значительную активацию транскрипта DN-CBRb в DN-CBRb + / ROSA-CAG-rtTA + ткани, но не в DN- CBRb + / ROSA-CAG-rtTA (рисунок 9C).Более того, анализы RT-PCR не только подтвердили индуцибельность системы, не показав активации трансгена у мышей DN-CBRb + / ROSA-CAG-rtTA , но также продемонстрировали повышенную концентрацию трансгена. в CBRb + / ROSA-CAGRTTA + животных.

    РИСУНОК 9. Пространственный анализ активации трансгена DN-CBRb в P18 DN-CBRb + / ROSA-CAG-rtTA + и DN-CBRb + / ROSA-CAG-rtTA мышей сердце, глаз, легкие и улитка. (A) Подтверждая эффективность Dox-опосредованной активации трансгена, экспрессия эндогенного RB1 была подавлена ​​в тканях CBRb + / ROSA-CAG-rtTA + (+), но не в CBRb / ROSA-CAG-rtTA + (-) контрольные ткани мышей. Денситометрический анализ выполняли, как описано на фиг. 4. Относительные уровни экспрессии RB1 показаны под каждым блотом. (B) Графическое изображение нормализованных уровней экспрессии RB1 в зависимости от различных тканей.Индивидуальные вариации уровней эндогенного RB1 могут объяснить различия в индивидуальных ответах на активацию трансгена и подавление RB1. (C) RT-PCR-анализы глаза, сердца и улитки выявили значительную активацию транскрипта DN-CBRb в обработанных dox тканях DN-CBRb + / ROSA-CAG-rtTA + , но не в тканях. DN-CBRb + / ROSA-CAG-rtTA . CBRb + / rtTA + = DN-CBRb + / ROSA-CAG-rtTA + ; CBRb / rtTA + = DN-CBRb / ROSA-CAG-rtTA + ; CBRb + / rtTA = DN-CBRb + / ROSA-CAG-rtTA .* P <0,05.

    Эндогенная экспрессия Rb1 подвержена временным и пространственным вариациям (Hamel et al., 1993; Moore et al., 1996; Mantela et al., 2005). Настоящие результаты, полученные из четырех разных тканей мышей P18 в сочетании с нашей предыдущей серией экспериментов (рис. 7A – D) на улитках мышей P36, подтверждают как временную, так и пространственную эффективность активации трансгена DN-CBRb, а также использование Модель мыши DN-CBRb в различных исследованиях, посвященных манипулированию RB1 в разные постнатальные моменты времени.

    Экспрессия DN-CBRb в улитке мыши

    Для исследования клеточно-специфической экспрессии трансгена DN-CBRb, обработанные Dox и необработанные (контроль) P21 DN-CBRb + / ROSA-CAG-rtTA + улитки мышей подвергали ISH с трансген-специфическим рибозонды. Поддерживая эффективную активацию и жесткую регуляцию трансгена, сильный цитоплазматический и ядерный сигнал был обнаружен в области IHCs, включая клетки внутреннего столба и пограничные клетки, по всей длине улитки (Figures 10A-E).Сходным образом сигнал гибридизации наблюдался на дополнительных клетках по всей длине улитки (Рисунки 10B, C – E), указывая на эффективную передачу трансгена дочерним клеткам. На контрольных образцах не наблюдалось сигнала гибридизации (данные не показаны). Легкий сигнал гибридизации также наблюдался в цитоплазме внешних HCs, клеток Дейтерса, клеток внешнего столба и нейронов спирального ганглия (Фигуры 10D, F). Обнаружение трансгена в цитоплазме дополнительно свидетельствует об эффективном переносе мРНК DN-CBRb из ядер клеток для трансляции в активные белки.Примечательно, что мозаичная экспрессия трансгена, которая является частью внутренней природы трансгенных конструкций, также наблюдалась при экспрессии DN-CBRb (Фигуры 10A-F). Такой феномен, вероятно, является результатом неполной рекомбинации, что является обычным явлением, связанным с трансгенными конструкциями. Следовательно, неполная рекомбинация, связанная с присущей мозаичной экспрессией систем, индуцируемых rtTA, может объяснить, по крайней мере частично, неоднородный паттерн избыточных клеток, наблюдаемый на мышах DN-CBRb + / ROSA-CAG-rtTA + .

    РИСУНОК 10. Экспрессия трансгена DN-CBRb в улитке мыши P21 DN-CBRb + / ROSA-CAG-rtTA + . (A – F) Сильный цитоплазматический и ядерный сигнал ISH наблюдался во внутренних волосковых клетках (IHC), в области обработанных Dox DN-CBRb + / ROSA-CAG-rtTA + улитки мыши. (A – D) Экспрессия трансгена была обнаружена по всей длине улитки, но заметно сильнее в средней и базальной областях по сравнению с вершиной улитки.Наблюдалась мозаичная экспрессия DN-CBRb (стрелки), что может указывать на неполную рекомбинацию в этих клетках. Аналогичным образом, избыточные клетки (звездочка) показали сильный сигнал гибридизации, что свидетельствует об эффективной передаче трансгена во вновь образованные клетки. (E) Срезы улитки, окрашенные Nuclear Fast Red, подтвердили наши наблюдения на препаратах целых препаратов и позволили лучше оценить избыточный IHC (звездочка), а также некоторую экспрессию легкого трансгена в нейронах спирального ганглия ( F) .SGN, нейроны спирального ганглия; Бар = 10 мкм.

    Временное

    Rb1 Подавление в DN-CBRb + / ROSA-CAG-rtTA + Результаты мыши в избыточных клетках внутреннего волоса

    Чтобы лучше понять возможные последствия временно регулируемого ингибирования RB1 во внутреннем ухе, улитки DN-CBRb + / ROSA-CAG-rtTA + и DN-CBRb / ROSA-CAG-rtTA + мышей на P10 и P28 препарировали и подвергали иммуногистохимии с антителом против маркера HC Myosin VIIa (M7a).На сегодняшний день проанализировано всего 40 ушей (пять мышей на генотип × 2 временных точки). В то время как в улитке мышей DN-CBRb / ROSA-CAG-rtTA + изменений не наблюдалось, избыточные M7a-положительные клетки наблюдались в области IHCs DN-CBRb + /. ROSA-CAG-rtTA + улитки в двух проанализированных временных точках (Рисунки 11A – K). Был проведен подсчет этих лишних клеток, и результаты сравнились между разными поворотами улитки (т.е., вершина, середина и основание) и временные точки на t -тест (Рисунок 11L). Статистических различий в концентрации дополнительных клеток между средним и базальным поворотами в любой временной точке не наблюдалось. Тем не менее, сравнение количества лишних клеток в комбинированном среднем и базальном поворотах и ​​апикальном повороте оказалось значимым ( p <0,05). Аналогичным образом, мышь DN-CBRb + / ROSA-CAG-rtTA + на P10 показала значительно больше дополнительных клеток ( p <0.05), чем на P28. Эти результаты согласуются с паттерном экспрессии эндогенного гена Rb1 в улитке мышей (Mantela et al., 2005), показывая градиент экспрессии от основания к верхушке, который подавляется во время постнатального развития. Следует отметить, что существенных изменений в OHC не наблюдалось. Затем, чтобы начать сбор информации о морфологии этих дополнительных клеток, мы искали наличие и морфологию стереоцилий с помощью фаллоидинового мечения DN-CBRb + / ROSA-CAG-rtTA + улитки на P10.В целом, не наблюдалось видимых различий по морфологии, плотности и ориентации стереоцилий между дополнительными и регулярными IHCs на P10 (Рисунки 12A – C). В настоящее время проводятся дополнительные анализы для оценки функциональности и созревания вновь созданных углеводородов.

    РИСУНОК 11. Иммуногистохимическое обнаружение миозин VIIa (M7a) -положительных сверхкомплектных клеток в улитках DN-CBRb + / ROSA-CAG-rtTA + (CBRb) на 10-й день постнатального (P) 28 P . По сравнению с контролем DN-CBRb + / ROSA-CAG-rtTA (WT), который показывает одну линию клеток в области IHC по всей длине улитки (A, D, G) , P10 (B, E, H – J) и P28 (C, F, K) мутанты CBRb демонстрировали дополнительные M7a-положительные клетки (стрелки и области в рамке), которые были больше сконцентрированы в базальных и средние витки улитки. Следует отметить, что плотность лишних клеток была выше в ушах P10 по сравнению с P28.Крупный план выделенных областей в (B, E) показан в (I) и (J) соответственно. Область в прямоугольнике в (J) выделяет область, в которой IHC отображаются в виде двойного ряда. Синий фон на всех рисунках соответствует окрашиванию DAPI. Бар = 10 мкм. (L) Подсчет миозин VIIa-положительных клеток в области IHCs улитки мышей CBRb на P10 выявил значительное увеличение количества клеток, особенно в среднем и базальном поворотах, по сравнению с DN-CBRb / ROSA -CAG-rtTA + мышей.Планки погрешностей показывают SEM. * P <0,05.

    РИСУНОК 12. Иммуногистохимическая локализация стереоцилий и пролиферирующих клеток на DN-CBRb + / ROSA-CAG-rtTA + улитки мыши. (A – C) Окрашивание P10 CBRb + / ROSA-CAG-rtTA + фаллоидином улитки мыши выявило присутствие F-актин-положительных стереоцилий-подобных структур (стрелки). Из-за своеобразной анатомии улитки (B, C) были повернуты для облегчения визуализации стереоцилий. (D) EdU (зеленый) маркировка в DN-CBRb + / ROSA-CAG-rtTA + (CBRb) на P10 не показала распространения в ОК; однако несколько EdU-положительных клеток наблюдались на большом эпителиальном гребне. Звездочки обозначают лишние ячейки. DAPI = синий; Миозин VIIa = красный. Бар = 10 мкм.

    Незапланированная пролиферация клеток внутреннего уха после полной или условной делеции RB1 обычно приводит к массовой гибели клеток (Mantela et al., 2005; Sage et al., 2005, 2006). В отсутствие каких-либо выявляемых апоптозных признаков улитки DN-CBRb + / ROSA-CAG-rtTA + , обработанной Dox, мы провели иммуногистохимический анализ с использованием специфических антител для выявления любой потенциальной активности активной каспазы 3 в этих улитках. Cochleae мышей на P10. Улитки, обработанные стауроспорином, использовали в качестве положительного контроля. Не наблюдалось положительного мечения каспазой 3, за исключением одного положительного ядра на базальном повороте одной из десяти проанализированных улиток (данные не показаны).Аналогичным образом, маркировка EdU улитки DN-CBRb + / ROSA-CAG-rtTA + не выявила каких-либо обнаруживаемых признаков пролиферации в ОК (фигура 12D). Однако EdU-положительные клетки все еще наблюдались в большом эпителиальном гребне (фиг. 12D), что позволяет предположить, что пролиферация клеток, дающих начало избыточным HC, имела место раньше в течение 10 дней лечения Dox. Дополнительные анализы улиток мышей DN-CBRb + / ROSA-CAG-rtTA + , подвергнутых более коротким периодам лечения Dox, вероятно, прольют свет на время, когда имеет место пролиферация.В ушах контрольных мышей DN-CBRb / ROSA-CAG-rtTA + не наблюдалось EdU-положительных клеток (данные не показаны).

    Обсуждение

    В то время как использование мышей с нокаутом Rb1 (KO) высветило потенциальную роль Rb1 в регенерации HC, ранняя эмбриональная летальность мышей Rb1 KO создает серьезные ограничения для проведения любых дальнейших исследований регенерации in vivo , в частности на поздних эмбриональных и постнатальных стадиях (Lee et al., 1992; Wu et al., 2003; Mantela et al., 2005; Sage et al., 2005, 2006). Более того, условная делеция Rb1 в специфических тканях с использованием системы Cre / lox не всегда прямолинейна (Weber et al., 2008; Turlo et al., 2010). Чтобы обойти проблемы, связанные с такими подходами, мы стремились создать модель мыши, в которой RB1 может быть условно инактивирован путем сверхэкспрессии мутантного DN RB1 пространственно-временным способом. Для отмены функции эндогенного RB1 был предложен ряд вариантов (Dick, 2007; Macpherson, 2008).Лучшей альтернативой была бы такая, которая приводит не только к инактивации эндогенного RB1, но и к его протеолитической деградации. Такая трансгенная конструкция была ранее описана в другом месте (Higashitsuji et al., 2000; Li et al., 2000). Однако, хотя он и элегантен, ему не хватало механизма для контроля активации трансгена, ответа или тканевой специфичности. Мы создали индуцибельную модель трансгенной мыши RB1 DN, которая сочетает в себе прямую стратегию Dox-зависимой транскрипционной системы со слиянием лизосомальной протеазы CB с Rb1 для создания модели мыши с временной регуляцией Dox-опосредованной DN-RB1.В отличие от других методов конструирования мутации DN, предлагаемый метод требует минимальных знаний о структуре и функции гена и потенциально может быть применен к любому интересующему гену (Li et al., 2000). Более того, возможно, наиболее захватывающим аспектом этого метода является обратимость индуцибельной экспрессии трансгена in vitro и in vivo после отзыва Dox.

    Rb1 представляет собой классический ген-супрессор опухоли с множеством функций, от репликации ДНК до митоза, репарации ДНК, контроля контрольных точек повреждения ДНК, клеточного старения, дифференцировки и апоптоза (Кореняк и Брем, 2005).Помимо канонического связывания с E2F во время фазы G1 и регуляции пролиферации, RB1 связывается с рядом факторов транскрипции посредством белок-белковых взаимодействий, чтобы регулировать тканеспецифические функции (Welch and Wang, 1993; Dick and Dyson, 2003). Насколько нам известно, нет никаких доказательств прямого физического взаимодействия между молекулами RB1. Тем не менее, мы предполагаем, что некоторые из многочисленных молекул, связывающих RB1, будут иметь несколько сайтов RB1, таким образом, допуская присутствие нескольких молекул RB1 в данный момент времени.В соответствии с нашей гипотезой, BRCA1, как было показано, имеет сайты связывания RB1 как на C-, так и на N-конце (Aprelikova et al., 1999; Yarden and Brody, 1999). В этом свете, если одна из молекул RB1 является мутантом DN, это будет препятствовать тому, чтобы RB1-содержащий комплекс выполнял свою нормальную роль, снижая эндогенные уровни RB1 и вызывая фенотип с нулевым RB1 (Kominami et al., 1991). Хотя полные биохимические механизмы, лежащие в основе активности DN-CBRb, еще не раскрыты, подавление in vivo, и in vitro эндогенного белка RB1 после лечения Dox предполагает, что, как и белок BRCA1, большее количество членов взаимодействующего элемента RB1 может имеют несколько сайтов связывания RB1.

    В дополнение к его общепризнанной важности в развитии и исследованиях рака, особое внимание было уделено роли Rb1 в регенерации тканей (Bakay et al., 2006; Wang et al., 2013), особенно регенерации слуховых HC (Mantela et al., 2005; Sage et al., 2005, 2006; Weber et al., 2008). В течение последних 8 лет, используя слуховую систему в качестве модели, мы и другие показали, что манипуляции с геном Rb1 или конкретными компонентами пути Rb1 запускают незапланированную пролиферацию митотически неподвижных нейросенсорных HCs и их клонально связанных поддерживающие клетки (Mantela et al., 2005; Сейдж и др., 2005; Weber et al., 2008; Rocha-Sanchez et al., 2011, 2013). Хотя растущий набор молекулярных методов в значительной степени способствовал нашему пониманию многогранной роли Rb1 , на сегодняшний день ни один подход не был эффективным для понимания активности RB1 без постоянного устранения его активности, что при Rb1 ‘ Широкий спектр взаимодействий обычно приводит либо к снижению жизнеспособности, либо к заболеваемости (Lee et al., 1992; Wu et al., 2003). Что касается регенерации ткани, индуцированная и обратимая временная инактивация RB1 и связанных с ним факторов может привести к экспансии клеток-мишеней без запуска гибели клеток, потому что функция RB1 будет восстановлена ​​после отмены индукции Dox.

    Мы создали модель мыши, которая позволяет индуцибельный, обратимый и временный контроль ингибирования белка RB1 в различном постнатальном возрасте. Первоначальные исследования на мышах DN-CBRb демонстрируют доказательство концепции индуцибельного и обратимого ингибирования эндогенной экспрессии RB1.В настоящем исследовании мы использовали общую линию индуктора тетрациклина ROSA-CAG-rtTA для запуска экспрессии DN-CBRb. In vivo и in vitro Анализы подтверждают эффективность этой модели по индукции пролиферации клеток на довольно умеренных уровнях по сравнению с традиционной моделью мыши Rb1 -KO, не вызывая апоптоза (Mantela et al., 2005; Sage et al., др., 2005, 2006; Weber et al., 2008). В отличие от ранее описанных моделей мышей Rb1 , остаточная экспрессия белка RB1 все еще наблюдается в DN-CBRb + / ROSA-CAG-rtTA + .Такие уровни экспрессии RB1 кажутся достаточно низкими, чтобы освободить эти покоящиеся клетки от их постмитотической остановки, но не для запуска апоптоза, как предполагается из наших настоящих результатов. На данный момент у нас нет экспериментальных доказательств апоптотической гибели клеток после Dox-опосредованной активации DN-CBRb либо in vitro , либо in vivo . Не менее значительным открытием было наблюдение избыточных клеток M7a в улитках мышей DN-CBRb + / ROSA-CAG-rtTA + в двух разных постнатальных временных точках.Хотя количество дополнительных клеток было выше на P10, чем на P28, в слуховом поле хорошо установлено, что пролиферация клеток не происходит естественным образом после выхода клеток из клеточного цикла, что происходит во время эмбрионального развития. Следовательно, даже меньшее количество дополнительных ячеек на P28 по-прежнему является положительным результатом. Более того, подтверждая специфичность активности трансгена и согласуясь с паттерном экспрессии Rb1 в постнатальной улитке (Mantela et al., 2005), экспрессия трансгена и полученные в результате дополнительные клетки, по-видимому, следуют градиенту концентрации от основания к вершине, который наиболее заметен в области IHC, где ранее была описана экспрессия Rb1 (Mantela et al., 2005 ). Фактически, все собранные до сих пор доказательства предполагают, что избыточные клетки в улитках мышей DN-CBRb + / ROSA-CAG-rtTA + могли возникнуть в результате пролиферации тех клеток, которые демонстрируют активацию Трансген DN-CBRb, особенно поддерживающие клетки, связанные с внутренними ИГК.

    Селективное подавление экспрессии генов является одновременно экспериментальным инструментом для определения функции и потенциальным средством медицинской терапии. Хотя наши исследования сосредоточены на слуховой системе, ввиду центральной роли, которую RB1 играет в различных процессах заболевания, и отсутствия доступных моделей на животных для модуляции его активности, модель DN-CBRb должна быть ценным ресурсом для исследователей из различных областей медицины. учиться. В то время как молекулярная этиология опухоли глаза ретинобластомы является одной из самых простых среди всех видов рака человека (Goodrich, 2006), значимость функциональной сложности и взаимодействий RB1, а также его значимость для нормального развития и злокачественных новообразований еще не завершена.Например, мутации зародышевой линии в RB1 предрасполагают человека к очень ограниченному набору рака (Kovesdi et al., 1987; Roarty et al., 1988). Напротив, соматические мутации в RB1 или в членах его интерактома, по-видимому, вносят вклад в злокачественные новообразования в самых разных тканях. Эта очевидная временная зависимость от функции Rb1 только увеличивает текущий разрыв между молекулярными исследованиями регуляции гена, опосредованного Rb1 , и результирующими фенотипами in vivo . Хотя Rb1 инактивирован при большинстве злокачественных новообразований, некоторые типы рака, такие как рак толстой кишки, требуют конститутивной экспрессии RB1 для поддержания пролиферации и предотвращения апоптоза (Ali et al., 1993; Du and Searle, 2009; Collard et al., 2012). В таких сценариях временное ингибирование функции RB1 потенциально может привести к уничтожению раковых клеток или увеличению их чувствительности к радио- или химиотерапевтическим агентам (Knudsen and Knudsen, 2008; Du and Searle, 2009). С другой стороны, в слуховой системе временно контролируемое подавление RB1 может предлагать альтернативу возвращению митотически покоящихся клеток обратно в клеточный цикл в качестве средства для регенерации потерянных сенсорных HCs.

    Таким образом, мы создали новую индуцибельную, регулируемую и обратимую мышиную модель DN-CBRb, которая является первой моделью на животных, в которой достигается ингибирование DN белка RB1.Чтобы проверить эффективность конструкции и потенциал модели мыши DN-CBRb, мы скрестили ее с общей линией мышей rtTA. Однако для достижения тканеспецифического ингибирования RB1 мышей DN-CBRb можно скрестить с любой другой линией индукторов, что делает их подходящей моделью для множества различных исследований в слуховой системе и в других местах.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Эта работа была частично поддержана новым исследовательским грантом от Health Hearing Foundation (S. Tarang) и премией институционального развития (IDeA) Национального института общих медицинских наук Национального института здравоохранения в рамках гранта № P20 GM103471. Мы благодарим докторов наук. Маршаллу Хорвицу (Вашингтонский университет) и Федерико Калинеку за предоставление вектора pCS2 + CB-Myc 6 и клеточной линии HEI-OC1 соответственно. Мы также благодарим г.Умешу Пякурелу за ценную техническую помощь. Конфокальная микроскопическая система была предоставлена ​​Небраским центром клеточной биологии (NCCB) при университете Крейтон.

    Список литературы

    Адамс, П. Д. (2001). Регулирование белка-супрессора опухоли ретинобластомы циклином / cdks. Биохим. Биофиз. Acta 1471, M123 – M133. DOI: 10.1016 / S0304-419X (01) 00019-1

    CrossRef Полный текст | Google Scholar

    Али, А.А., Маркус, Дж. Н., Харви, Дж.П., Ролл, Р., Ходжсон, К. П., Вильдрик, Д. М. и др. (1993). Белок RB1 в нормальных и злокачественных клеточных линиях колоректальной ткани и рака толстой кишки человека. FASEB J. 7, 931–937.

    Pubmed Реферат | Pubmed Полный текст | Google Scholar

    Апреликова О.Н., Фанг, Б.С., Мейснер, Э.Г., Коттер, С., Кэмпбелл, М., Кутиала, А., и др. (1999). Остановка роста, связанная с BRCA1, зависит от RB. Proc. Natl. Акад. Sci. США 96, 11866–11871. DOI: 10.1073 / pnas.96.21.11866

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Бакай, М., Ван, З., Мелкон, Г., Шильц, Л., Сюань, Дж., Чжао, П. и др. (2006). Дистрофии ядерной оболочки обнаруживают транскрипционный отпечаток пальца, предполагающий нарушение путей Rb-MyoD в регенерации мышц. Мозг 129, 996–1013. DOI: 10.1093 / brain / awl023

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Барритт, Л.С., Миллер, Дж.М., Шитц, Л. Р., Гарднер, К., Пирс, М. Л., Соукуп, Г. А. и др. (2012). Условная делеция гена ортолога человека Dicer1 в домене экспрессии Pax2-Cre нарушает орофациальное развитие. Indian J. Hum. Genet. 3, 310–319. DOI: 10.4103 / 0971-6866.107984.

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Чано Т., Саджи М., Иноуэ Х., Минами К., Кобаяши Т., Хино О. и др. (2006). Нервно-мышечное изобилие RB1CC1 вносит вклад в непролиферирующий фенотип увеличенных клеток как за счет поддержания RB1, так и за счет деградации TSC1. Внутр. J. Mol. Med. 18, 425–432. DOI: 10.3892 / ijmm.18.3.425

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Коллард, Т. Дж., Урбан, Б. К., Пацос, Х. А., Гаага, А., Таунсенд, П. А., Параскева, К., и др. (2012). Белок ретинобластомы (Rb) как антиапоптотический фактор: экспрессия Rb необходима для антиапоптотической функции белка BAG-1 в клетках колоректальной опухоли. Смерть клетки. Дис. 3, е408. DOI: 10.1038 / cddis.2012.142

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Ду В. и Сирл Дж. С. (2009). Путь rb и лечение рака. Curr. Мишени для лекарств. 10, 581–589. DOI: 10.2174 / 138945009788680392

    CrossRef Полный текст | Google Scholar

    Гуо, Дж., Лонгшор, С., Наир, Р., Уорнер, Б. У. (2009). Белок ретинобластомы (pRb), но не p107 или p130, необходим для поддержания покоя и дифференцировки энтероцитов в тонком кишечнике. J. Biol. Chem. 284, 134–140. DOI: 10.1074 / jbc.M806133200

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Хэмел П. А., Филлипс Р. А., Манкастер М. и Галли Б. Л. (1993). Размышления о роли RB1 в тканеспецифической дифференцировке, инициации опухоли и прогрессии опухоли. FASEB J. 7, 846–854.

    Pubmed Реферат | Pubmed Полный текст | Google Scholar

    Хигасицудзи, Х., Ито, К., Нагао, Т., Доусон, С., Ноногучи, К., Кидо, Т. и др. (2000). Снижение стабильности белка ретинобластомы ганкирином, онкогенным белком с анкириновыми повторами, сверхэкспрессируемым в гепатомах. Nat. Med. 6, 96–99. DOI: 10.1038 / 71600

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Кайзер, К. Л., Камиен, А. Дж., Шах, П. А., Чепмен, Б. Дж., И Котанч, Д. А. (2009). Мечение 5-этинил-2’-дезоксиуридином позволяет выявлять пролиферирующие клетки в регенерирующей улитке птиц. Ларингоскоп 119, 1770–1775. DOI: 10.1002 / lary.20557

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Кнудсон А. Дж. Младший (1971). Мутация и рак: статистическое исследование ретинобластомы. Proc. Natl. Акад. Sci. США 68, 820–823. DOI: 10.1073 / pnas.68.4.820

    CrossRef Полный текст | Google Scholar

    Ли, Э. Ю., Чанг, К. Ю., Ху, Н., Ван, Ю. К., Лай, К. К., Херруп, К. и др. (1992). Мыши с дефицитом Rb нежизнеспособны и обнаруживают дефекты нейрогенеза и гематопоэза. Природа 359, 288–294. DOI: 10.1038 / 359288a0

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Ли, Ф. К., Кунрод, А., и Хорвиц, М. (1996). Предпочтительное образование гомодимера MyoD продемонстрировано общим методом доминантно-отрицательной мутации с использованием слияния с лизосомальной протеазой. J. Cell Biol. 135, 1043–1057. DOI: 10.1083 / jcb.135.4.1043

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Ли, Ф.К., Кунрод А. и Хорвиц М. (2000). Отбор доминантно-негативного белка ретинобластомы (RB), ингибирующего дифференцировку сателлитных миобластов, подразумевает косвенное взаимодействие между MyoD и RB. Мол. Cell Biol. 20, 5129–5139. DOI: 10.1128 / MCB.20.14.5129-5139.2000

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Mantela, J., Jiang, Z., Ylikoski, J., Fritzsch, B., Zacksenhaus, E., and Pirvola, U. (2005). Путь гена ретинобластомы регулирует постмитотическое состояние волосковых клеток внутреннего уха мыши. Развитие 132, 2377–2388. DOI: 10.1242 / dev.01834

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Мур, Г. Д., Аябе, Т., Копф, Г. С., и Шульц, Р. М. (1996). Временные паттерны экспрессии генов G1-S циклинов и cdks во время первого и второго митотических клеточных циклов у эмбрионов мыши. Мол. Репродукция. Dev. 45, 264–275. DOI: 10.1002 / (SICI) 1098-2795 (199611) 45: 3 <264 :: AID-MRD2> 3.0.CO; 2-квартал

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Моррис, Э.Дж. И Дайсон Н. Дж. (2001). Белковые партнеры ретинобластомы. Adv. Cancer Res. 82, 1–54. DOI: 10.1016 / S0065-230X (01) 82001-7

    CrossRef Полный текст | Google Scholar

    Роарти, Дж. Д., Маклин, И. У., и Циммерман, Л. Е. (1988). Заболеваемость вторичными новообразованиями у пациентов с двусторонней ретинобластомой. Офтальмология 95, 1583–1587. DOI: 10.1016 / S0161-6420 (88) 32971-4

    CrossRef Полный текст | Google Scholar

    Роша-Санчес, С. М., Scheetz, L.R., Contreras, M., Weston, M.D., Korte, M., McGee, J., et al. (2011). У зрелых мышей, лишенных гена Rbl2 / p130, имеются избыточные волосковые клетки внутреннего уха и поддерживающие клетки. J. Neurosci. 31, 8883–8893. DOI: 10.1523 / JNEUROSCI.5821-10.2011

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Роша-Санчес, С. М., Шитц, Л. Р., Сиддики, С., Уэстон, М. Д., Смит, Л. М., Демпси, К. и др. (2013). Отсутствие эффектов Rbl1 / p107 на пролиферацию и созревание клеток внутреннего уха. J. Behav. Brain Sci. 3, 534–555. DOI: 10.4236 / jbbs.2013.37056

    CrossRef Полный текст | Google Scholar

    Сейдж К., Хуанг М., Карими К., Гутьеррес Г., Воллрат М. А., Чжан Д. С. и др. (2005). Пролиферация функциональных волосковых клеток in vivo в отсутствие белка ретинобластомы. Наука 307, 1114–1118. DOI: 10.1126 / science.1106642

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Сейдж, К., Хуанг, М., Воллрат, М. А., Браун, М. К., Хайндс, П. У., Кори, Д. П. и др. (2006). Существенная роль белка ретинобластомы в развитии волосковых клеток и слухе у млекопитающих. Proc. Natl. Акад. Sci. США 103, 7345–7350. DOI: 10.1073 / pnas.0510631103

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Шерр, К. Дж., И Маккормик, Ф. (2002). Пути RB и p53 при раке. Cancer Cell 2, 103–112. DOI: 10.1016 / S1535-6108 (02) 00102-2

    CrossRef Полный текст | Google Scholar

    Вс, Х., Chang, Y., Schweers, B., Dyer, M.A., Zhang, X., Hayward, S.W. и др. (2006). Белок Rb1 с дефицитом связывания E2F частично устраняет дефекты развития, связанные с нулевым риском Rb1. Мол. Cell Biol. 26, 1527–1537. DOI: 10.1128 / MCB.26.4.1527-1537.2006

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Томас Д. М., Карти С. А., Пископо Д. М., Ли, Дж. С., Ван, В. Ф., Форрестер, В. К. и др. (2001). Белок ретинобластомы действует как коактиватор транскрипции, необходимый для остеогенной дифференцировки. Мол. Cell 8, 303–316. DOI: 10.1016 / S1097-2765 (01) 00327-6

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Турло, К. А., Галлахер, С. Д., Вора, Р., Ласки, Ф. А., и Ируэла-Ариспе, М. Л. (2010). Когда cre-опосредованная рекомбинация у мышей не приводит к потере белка. Генетика 186, 959–967. DOI: 10.1534 / genetics.110.121608

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Ван, Л., Лу, А. П., Ю, З. Л., Вонг, Р. Н., Биан, З. Х., Квок, Х. Х. и др. (2014). Эффект ингибирования меланогенеза и чрескожное введение гинсенозида Rb1. AAPS. Pharm. Sci. Тех 15, 1252–1262. DOI: 10.1208 / s12249-014-0138-3

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Wang, Y., Tian, ​​Y., Morley, M. P., Lu, M. M., Demayo, F. J., Olson, E. N., et al. (2013). Развитие и регенерация предшественников эндодермы Sox2 + регулируется регуляторным путем Hdac1 / 2-Bmp4 / Rb1. Dev. Cell 24, 345–358. DOI: 10.1016 / j.devcel.2013.01.012

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Вебер, Т., Корбетт, М.К., Чоу, Л.М., Валентайн, М.Б., Бейкер, С.Дж. и Цзо, Дж. (2008). Быстрый повторный вход в клеточный цикл и гибель клеток после острой инактивации продукта гена ретинобластомы в постнатальных волосковых клетках улитки. Proc. Natl. Акад. Sci. США 105, 781–785. DOI: 10.1073 / pnas.0708061105

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Ву, Л., de Brunin., A., Saavedra, H. I., Starovic, M., Trimboli, A., Yang, Y., et al. (2003). Внеэмбриональная функция Rb важна для эмбрионального развития и жизнеспособности. Nature 421, 942–947. DOI: 10.1038 / nature01417

    Pubmed Реферат | Pubmed Полный текст | CrossRef Полный текст | Google Scholar

    Чжу, М. X., Ран, Б., Фэн, З. К., и Пан, К. В. (2009). [Влияние Rb1 и Rg1 на экспрессию Bcl-2, Bax при апоптозе клеток HK-2, индуцированном сывороткой при ишемии / реперфузии почек]. Чжунго Ин Юн Шэн Ли Сюэ За Чжи 25, 496–499.

    Pubmed Реферат | Pubmed Полный текст | Google Scholar

    американских студентов-медиков, которые занимаются самообслуживанием, сообщают о меньшем стрессе и более высоком качестве жизни | BMC Medical Education

  • 1.

    Brazeau CM, Shanafelt T, Durning SJ, Stanford MF, Eacker A, Moutier C, Satele DV, Sloan JA, Dyrbye LN. Бедствие среди поступающих в институт студентов-медиков по сравнению с населением в целом. Acad Med. 2014. 89 (11): 1520–5.

    Артикул Google ученый

  • 2.

    Dyrbye LN, Thomas MR, Shanafelt TD. Систематический обзор депрессии, тревожности и других показателей психологического дистресса среди студентов-медиков из США и Канады. Acad Med. 2006; 8 (4): 354–73.

    Артикул Google ученый

  • 3.

    Гатри Э.А., Блэк Д., Шоу К.М., Гамильтон Дж., Крид Ф.Х., Томенсон Б. Начало медицинской карьеры: психологическая заболеваемость у студентов-медиков первого курса. Med Educ. 1995. 29 (5): 337–41.

    Артикул Google ученый

  • 4.

    Надежда V, Хендерсон М. Студент-медик, депрессия, тревога и дистресс за пределами Северной Америки: систематический обзор. Med Educ. 2014; 48: 963–79.

    Артикул Google ученый

  • 5.

    Маклин Л., Буз Дж., Балон Р. Влияние медицинской школы на психическое здоровье учащихся. Acad Psychiatry. 2016; 40 (1): 89–91.

    Артикул Google ученый

  • 6.

    Thompson G, McBride RB, Hosford CC, Halaas G.Устойчивость студентов-медиков: роль стиля совладания и социальной поддержки. Teach Learn Med. 2016; 28 (2): 174–82.

    Артикул Google ученый

  • 7.

    Ротенштейн Л.С., Рамос М.А., Торре М., Сигал Дж. Б., Пелусо М.Дж., Гилле С., Сен С., Мата Д.А. Распространенность депрессии, депрессивных симптомов и суицидальных мыслей среди студентов-медиков: систематический обзор и метаанализ. ДЖАМА. 2016; 316: 2214–36.

    Артикул Google ученый

  • 8.

    Richards KC, Campenni CE, Muse-Burke JL. Самопомощь и благополучие у специалистов в области психического здоровья: посреднические эффекты самосознания и внимательности. J Ment Health Couns. 2010; 32 (3): 247.

    Артикул Google ученый

  • 9.

    Gordon JS. Группы умственно-телесных навыков для студентов-медиков: снижение стресса, повышение приверженности и содействие уходу, ориентированному на пациента. BMC Med. 2014; 14: 198.

    Артикул Google ученый

  • 10.

    Pender NJ, Murdaugh C, Parsons M. Укрепление здоровья в медсестринской практике. 6-е изд. Река Аппер Сэдл, штат Нью-Джерси: Prentice Hall; 2010.

    Google ученый

  • 11.

    Айяла Е.Е., Омородион А.М., Нмеча Д., Винсеман Дж. С., Мейсон HRC. Что делают студенты-медики для самообслуживания? Подход к благополучию, ориентированный на студентов. Teach Learn Med. 2017; 3: 237–46.

    Артикул Google ученый

  • 12.

    Winseman JS, Higgins EA, Balkoski VI, Rosas SR. Что влияет на самочувствие во время медицинского образования? Концептуальная карта студентов и преподавателей. Ann Behav Sci Med Educ. 2015; 21 (1): 19–29.

    Артикул Google ученый

  • 13.

    Болл С., Бакс А. Самопомощь в медицинском образовании: эффективность коррекции привычек здоровья для студентов-медиков первого курса. Acad Med. 2002; 77: 911–7.

    Артикул Google ученый

  • 14.

    Gold JA, Johnson B, Leydon G, Rohrbaugh RM, Wilkins KM. Самопомощь в области психического здоровья у студентов-медиков: всесторонний взгляд на обращение за помощью. Acad Psychiatry. 2015; 39 (1): 37.

    Артикул Google ученый

  • 15.

    Гивенс Дж. Л., Тиа Дж. Депрессия в отношении использования студентами-медиками услуг в области психического здоровья и препятствий для использования. Acad Med. 2002; 77: 918–21.

    Артикул Google ученый

  • 16.

    Kliger B, Linde B, Katz NT. Стать врачом: качественная оценка проблем и возможностей в области благополучия студентов-медиков в течение третьего курса. Acad Med. 2013; 88: 535–40.

    Артикул Google ученый

  • 17.

    Бенбассат Дж. Нежелательные особенности среды медицинского обучения: повествовательный обзор литературы. Adv Health Sci Educational Theory Pract. 2013; 18: 527–36.

    Артикул Google ученый

  • 18.

    Тья Дж., Гивенс Дж. Л., Ши Дж. А. Факторы, связанные с недостаточным лечением депрессии студентов-медиков. J Am Coll Heal. 2005; 53: 219–24.

    Артикул Google ученый

  • 19.

    Burack JH, Irby DM, Carline JD, Root RK, Larson EB. Обучение состраданию и уважению: ответы лечащих врачей на проблемное поведение. J Gen Intern Med. 1999; 14: 49–55.

    Артикул Google ученый

  • 20.

    Славин С.Ю., Шиндлер Д.Л., Чибналл Дж.Т. Психическое здоровье студентов-медиков 3.0: улучшение самочувствия студентов за счет изменений в учебной программе. Acad Med. 2014. 89 (4): 573–7.

    Артикул Google ученый

  • 21.

    Славин С.Дж., Чибналл Дж.Т. Найти причину, изменить как: улучшение психического здоровья студентов-медиков, ординаторов и врачей. Acad Med. 2016. 91 (9): 1194–6.

    Артикул Google ученый

  • 22.

    Дролет, Британская Колумбия, Роджерс С. Комплексная программа оздоровления студентов-медиков — разработка и реализация в Медицинской школе Вандербильта. Acad Med. 2010; 85: 103–10.

    Артикул Google ученый

  • 23.

    Шапиро С.Л., Шварц Г.Е., Боннер Г. Влияние снижения стресса на основе внимательности на студентов медицинских и доврачебных специальностей. J Behav Med. 1998; 21: 581–99.

    Артикул Google ученый

  • 24.

    Кушнер РФ, Кесслер С, МакГаги WC. Использование планов изменения поведения для улучшения самообслуживания студентов-медиков. Acad Med. 2011; 86 (7): 901.

    Артикул Google ученый

  • 25.

    Хассед К., де Лиль С., Салливан Дж., Пьер С. Улучшение здоровья студентов-медиков: результаты комплексной программы осознанности и образа жизни. Adv Health Sci Educational Theory Pract. 2009. 14 (3): 387–98.

    Артикул Google ученый

  • 26.

    Ахерн Д., Фаррант К., Хикки Л., Хики Э., Макрат Л., МакГрат Д. Снижение стресса на основе осознанности для студентов-медиков: оптимизация удовлетворенности и вовлеченности студентов. BMC Med. 2016; 16: 209.

    Артикул Google ученый

  • 27.

    Dyrbye LN, Power DV, Massie FS, Eacker A, Harpter W, Thomas MR, Szydlo DW, Sloan JA, Shanafelt T. Факторы, связанные с сопротивлением и восстановлением после эмоционального выгорания: перспективное межведомственное исследование студентов-медиков.Med Educ. 2010; 44: 1016–26.

    Артикул Google ученый

  • 28.

    Макгрэйди А., Бреннан Дж., Линч Д., Уирти К. Программа оздоровления для студентов-медиков первого курса. Appl Psychophysiol Biofeedback. 2012; 37: 253–60.

    Артикул Google ученый

  • 29.

    Skevington SM, Lofty M, O’Connell KA. Оценка качества жизни WHOQOL-BREF Всемирной организации здравоохранения: психометрические свойства и результаты международного полевого испытания.Отчет группы WHOQOL. Qual Life Res. 2004. 13 (2): 299–310.

    Артикул Google ученый

  • 30.

    Бэбби ER. Логика выборки. В практике социальных исследований. 2004: 178–217.

  • 31.

    Ходжат М., Менджионе С., Наска Т.Дж., Раттнер С., Эрдманн Дж. Б., Гоннелла Дж. С., Маги М. Эмпирическое исследование снижения эмпатии в медицинской школе. Med Educ. 2004; 38: 934–41.

    Артикул Google ученый

  • 32.

    Коэн С., Кармарк Т., Мермельштейн Р. Глобальная мера воспринимаемого стресса. J Health Soc Behav. 1983; 24 (2): 385–96.

    Артикул Google ученый

  • 33.

    Коэн С., Уильямсон Г. В: Spacapan S, Oskamp S, редакторы. Воспринимаемый стресс в вероятностной выборке США. Социальная психология здоровья: Симпозиум Клермонта по прикладной социальной психологии; 1988.

    Google ученый

  • 34.

    Уокер С.Н., Сехрист К.Р., Пендер, штат Нью-Джерси. Профиль образа жизни, способствующий укреплению здоровья II Омаха. Медицинский центр Университета Небраски, Колледж медсестер: NE; 1995.

    Google ученый

  • 35.

    Актон Г.Дж., Малатум П. Статус базовой потребности и способствующее здоровью поведение в отношении самопомощи у взрослых. West J Nurs Res. 2000. 22 (7): 796–811.

    Артикул Google ученый

  • 36.

    Cohen J, Cohen P, West SG, Aiken LS.Применял множественный регрессионный / корреляционный анализ для поведенческих наук. 3-е изд. Нью-Йорк: Тейлор и Фрэнсис; 2003.

    Google ученый

  • 37.

    McClelland GH, Judd CM. Статистические трудности обнаружения взаимодействий и модераторных эффектов. Quant Meth Psych. 1993. 114 (2): 376–90.

    Google ученый

  • 38.

    Дирбай Л.Н., Шварц А., Даунинг С.М., Шидло Д.В., Слоан Д.А., Шанафельт ТД.Эффективность краткого скринингового инструмента для выявления студентов-медиков, терпящих бедствие. Acad Med. 2011; 86: 907–14.

    Артикул Google ученый

  • 39.

    Маршалл Л.Л., Эллисон А., Никамп Д., Ланке С. Воспринимаемый стресс и качество жизни среди студентов-докторов фармацевтических факультетов. Am J Pharm Educ. 2008; 72: 137.

    Артикул Google ученый

  • 40.

    Bidwal M, Ip E, Shah B, Serino M.Стресс, употребление наркотиков и алкоголя среди студентов-медиков: внимание к стимуляторам, отпускаемым по рецепту. J Pharm Pract. 2015; 28: 535–42.

    Артикул Google ученый

  • 41.

    Айяла Э., Эллис М., Грудев Н., Коул Дж. Женщины в программах психологии здравоохранения: стресс, самопомощь и качество жизни. Train Educ Prof Psychol. 2017; 11: 18–25.

    Google ученый

  • 42.

    Кемпер К., Мо Х, Хаят Р. Связаны ли внимательность и сострадание к себе со сном и стойкостью у медицинских работников? Журнал альтернативной и дополнительной медицины. 2015; 21: 496–503.

    Артикул Google ученый

  • 43.

    Schwenk TL, Davis L, Wimsatt LA. Депрессия, стигма и суицидальные мысли у студентов-медиков. ДЖАМА. 2010; 304: 1181–90.

    Артикул Google ученый

  • 44.

    Dyrbye LN, Thomas MR, Eacker A, Harper MFS Jr, Power DV, Huschka M, Novotny PJ, Sloan JA, Shanafelt TD. Раса, этническая принадлежность и благополучие студентов-медиков в США. Arch Intern Med. 2007. 167: 2103–9.

    Артикул Google ученый

  • 45.

    Hardeman RR, Przedworski JM, Burke SE, Burgess DJ, Phelan SM, Dovidio JF, Nelson D, Rockwood T., van Ryn M. Психическое благополучие студентов-медиков первого курса: сравнение по расе и полу : отчет об исследовании ИЗМЕНЕНИЯ студентов-медиков.J Расовые и этнические различия в здоровье. 2015; 2: 403–13.

    Артикул Google ученый

  • 46.

    Виталиано П.П., Майуро Р.Д., Руссо Дж., Митчелл Э.С. Бедствие студента-медика: продольное исследование. J Nerv Ment Dis. 1989. 177: 70–6.

    Артикул Google ученый

  • 47.

    Ричман Дж. А., Флаэрти Дж. А. Гендерные различия в стрессе студентов-медиков: вклад предшествующей социализации и текущего ролевого стресса.Soc Sci Med. 1990; 30: 777–87.

    Артикул Google ученый

  • 48.

    Lloyd C, Gartrell NK. Половые различия в психическом здоровье студентов-медиков. Am J Psychiatry. 1981; 138: 1346–51.

    Артикул Google ученый

  • 49.

    Camp DL, Hollingsworth MA, Zaccaro DJ, Cariaga-Lo LD, Richards BF. Влияет ли проблемная учебная программа на депрессию у студентов-медиков? Acad Med.1994; 69 (10 доп.): S25–7.

    Артикул Google ученый

  • 50.

    Бачкович Д.В., Живожинович Ю.И., Максимович Дж., Максимович М. Гендерные различия в академическом стрессе и выгорании среди студентов-медиков на последних курсах обучения. Психиатр Дунай. 2002; 24: 175–81.

    Google ученый

  • 51.

    Бабария П., Бернхейм С., Нуньес-Смит М. Гендерный и доклинический опыт студенток-медиков: систематика.Med Educ. 2011; 45 (3): 249–60.

    Артикул Google ученый

  • 52.

    Eley DS, Leung J, Hong BA, Cloninger KM, Cloninger CR. Выявление доминирующих личностных профилей у студентов-медиков: последствия для их благополучия и устойчивости. PLoS One. 2016 5 августа; 11: e0160028.

    Артикул Google ученый

  • 53.

    Dyrbye LN, Power DV, Massie F, Eacker A, Harper W, Thomas MR, Szydlo DW, Sloan JA, Shanafelt TD.Факторы, связанные с сопротивлением и восстановлением после выгорания: проспективное межведомственное исследование студентов-медиков в США. Med Educ. 2010; 44: 1016–26.

    Артикул Google ученый

  • 54.

    Tempski P, Santos IS, Mayer FB, Enns SC, Perotta B, Paro HB, Gannam S, Peleias M, Garcia VL, Baldassin S, Guimaraes KB. Взаимосвязь между устойчивостью студентов-медиков, образовательной средой и качеством жизни. PLoS One. 2015; 10 (6): e0131535.

    Артикул Google ученый

  • 55.

    Дирбай Л.Н., Харпер В., Мутье С., Дурнинг С.Дж., Пауэр Д.В., Масси Ф.С., Иакер А., Томас М.Р., Сатель Д., Слоан Д.А., Шанафельт Т.Д. Многопрофильное исследование, изучающее влияние позитивного психического здоровья на профессионализм студентов-медиков в эпоху сильного выгорания. Acad Med. 2012; 87: 1024–31.

    Артикул Google ученый

  • 56.

    Левин Р.Б., Хайдет П., Керн Д.Е., Бисли Б.В., Бенсингер Л., Брэди Д.В., Гресс Т., Хьюз Дж., Марваха А., Нельсон Дж., Райт С.М..Личностный рост во время стажировки: качественный анализ ответов стажеров на ключевые вопросы. J Gen Intern Med. 2006. 21 (6): 564–9.

    Артикул Google ученый

  • 57.

    Нарчал Р., Коуин Л.С., Уилсон И., Хардинг Д. Первый из первых: размышления студентов-медиков о личностном росте. Международный журнал обучения. 2012; 18: 353–64.

    Google ученый

  • 58.

    Moczko BTJ, Herzog W, Nikendei C.Воспринимаемый стресс при переходе на работу: качественное интервью с целью изучения потребностей студентов-медиков последнего курса. Adv Med Educ Pract. 2016; 7: 15–27.

    Google ученый

  • 59.

    Godefrooij MB, Diemers AD, Scherpbier AJ. Восприятие студентов о переходе к клинической фазе медицинской учебной программы с доклиническими контактами с пациентами; исследование фокус-группы. BMC Медицинское образование. 2010; 10: 28.

    Артикул Google ученый

  • 60.

    Американская ассоциация медицинских колледжей (AAMC). Кандидаты, поступающие впервые, поступающие и поступающие в медицинские школы США с разбивкой по полу, с 2005–2006 по 2015–2016 годы. Доступно по адресу https://www.aamc.org/data/facts/applicantmatriculant/ [последний доступ 4 декабря 2017 г.].

  • 61.

    Дирбай Л.Н., Томас М.Р., Харпер В., Мэсси Ф.С. мл., Пауэр Д.В., Иакер А., Шидло Д.В., Новотны П.Дж., Слоан Д.А., Шанафельт Т.Д. Учебная среда и выгорание студентов-медиков: многоцентровое исследование. Med Educ.2009. 43: 274–82.

    Артикул Google ученый

  • 62.

    Шанафельт Т.Д., Горриндж Дж., Менакер Р., Сторц К.А., Ривз Д., Бускерк С.Дж., Слоан Дж. А., Свенсен С.Дж.. Влияние организационного руководства на выгорание и удовлетворенность врачей. Mayo Clin Proc. 2015; 90: 432–40.

    Артикул Google ученый

  • 63.

    West CP, Dyrbye LN, Erwin PJ, Shanafelt TD. Вмешательства для предотвращения и уменьшения выгорания врачей: систематический обзор и метаанализ.Ланцет. 2016; 388: 2272–81.

    Артикул Google ученый

  • 64.

    Shanafelt TD, Noseworthy JH. Исполнительное руководство и благополучие врача: девять организационных стратегий, направленных на повышение вовлеченности и снижение выгорания.

  • Добавить комментарий

    Ваш адрес email не будет опубликован.